1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zlopas [31]
3 years ago
10

Explain how bacteria are both helpful and harmful to our bodies.

Biology
2 answers:
nexus9112 [7]3 years ago
7 0

This is the exact answer:

Bacteria are helpful because they produce oxygen, which our bodies need to breathe, and they help us to digest the food we eat. Bacteria are also helpful because they are used in medicine to help us overcome disease. Bacteria are harmful because they can cause tooth decay and illnesses that can be either common or quite serious.

yan [13]3 years ago
5 0
<span><span>Helpful bacteria: E. Coli are found in the intestines of humans and aid in digestion.
Streptomyces is used in making antibiotics.
Rhizobium are helpful bacteria found in the soil. They convert nitrogen in the soil.

Harmful bacteria:. Coli can also be harmful if food or water is contaminated with it and then eaten.
Listeriosis can cause individuals to become very ill and can even be potentially deadly. Examples of where it can be found are in shellfish, cold cuts, and unpasteurized milk.
Salmonella is very dangerous and lives in the intestinal tracts of humans . It is spread via feces. Foods like poultry and eggs can be contaminated with salmonella and cause severe diarrhea.
The human body contains numerous types of bacteria that are very beneficial and actually protect us from the harmful bacteria.</span></span>
You might be interested in
What is the complementary DNA of TACCGGATGCCAGATCAAATC?
Liono4ka [1.6K]

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary <u>DNA strand</u>.

7 0
4 years ago
Which of the following best describes Mendel's idea of segregation?
Mekhanik [1.2K]

Answer:

C

Explanation:

Since we know about mitosis and sexual reproduction, each parent passes on only one copy of the gene because they got a copy of a gene from each of their parent before, and the new child will end up with two genes, one from each parent.

5 0
3 years ago
scientific explanarions are based on empirical data and evidence. which of the following is not a scientific idea
svet-max [94.6K]
Genetic drift scientific explanarions are based on empirical data and evidence
7 0
4 years ago
How many nuclei will be left after the second half-life?
LiRa [457]

Answer:

4

Explanation:

8 0
3 years ago
How are diffusion and osmosis different? A. Osmosis is the movement of proteins. Diffusion is the movement of water. B. Osmosis
stepladder [879]
The answer is B, osmosis is the movement of water. Diffusion is the movement to chemicals and molecules.

Both osmosis and diffusion are movement of molecules from a region of higher concentration of the substance moving to lower concentration down the concentration gradient. However, osmosis is only for the movement of water molecules, while diffusion is for any type of substances including liquid or gas. So we can also say osmosis is a type of diffusion actually.

And also, both of these movement of molecules does not require extra energy, they all happen due to natural tendency.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The difference between macroevolution and microevolution is that: Please choose the correct answer from the following choices, a
    6·1 answer
  • What happens when a population is in hardy weinberg equilibrium apex?
    15·2 answers
  • _________ medicine is focused on growing specialized tissues for spinal cord injuries, diabetes, cancer, multiple sclerosis, Par
    14·1 answer
  • What do viruses need to reproduce? A. they need genetic material B. They need bacteria C. They need a host cell D. They need ins
    15·1 answer
  • May someone please help me?​
    7·1 answer
  • A ---------- is the thing that destroys other things​
    11·1 answer
  • Test due later help pls
    11·1 answer
  • Is mayonnaise real? I heard about it on twitter :/
    9·2 answers
  • Which of the following animals belongs in class Cepholopoda?
    6·2 answers
  • Purple flowers are dominant to pink. Two heterozygotes are crossed.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!