1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
8

If enough heat is added to a gas what would most likely happen?

Biology
1 answer:
pochemuha3 years ago
4 0

Answer:

When you heat a gas, both its vapor pressure and the volume it occupies increase. The individual gas particles become more energetic and the temperature of the gas increases. At high temperatures, the gas turns into a plasma.

Explanation:

You might be interested in
Hello please help i’ll give brainliest
Butoxors [25]

Answer:

abiotic

Explanation:

abiotic - nonliving components of an ecosystem that can affect the living organisms.

Temperature is a nonliving component and it affects the organisms that live within a certain environment.

Therefore the answer is Abiotic

Reasons its not the other answers:

Biotic factors must be living things

Temperature is not a living thing therefore Biotic cannot be the answer

Same with living, temperature is not living therefore the answer cannot be living.

Temperature plays a huge role in an ecosystem therefore it is considered an important component and the answer cannot be unimportant.

5 0
3 years ago
HELP!! If you live in Denver, you often need to adjust your baking times.<br> A. True<br> B. False
nlexa [21]

Answer:

its true man

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following is NOT a typical way that hormones function? a. Hormones control the transport of solutes across cell mem
Afina-wow [57]

Answer: d. Hormones control the size and shape of target cells.

Explanation:

A hormone is a substance that is released by some parts of the body but they are effective for causing an effect on the other parts or cells typically called as  target cells or organs. These are responsible for controlling the physiological functions in the body of the organism.

The hormones does not change the shape and size of the target cells instead they cause the target cells to perform metabolic functions required for living.

3 0
3 years ago
Read 2 more answers
Which nursing actions are necessary to prepare a perinatal patient for research?
Bezzdna [24]
The necessary actions are 
<span>- Inform the patient about her rights
</span><span>- Obtain consent from the patient
</span>
To be ethical, we should fully give informations to the perinatal patient about research without concealing anything. Including the potential side effects of the research and the payment/benefit that they patients would get if they agree to be a part of it
6 0
3 years ago
Radioactive Decay _______.
Tju [1.3M]
C. Gives off heat


deadly heat in fact
5 0
3 years ago
Read 2 more answers
Other questions:
  • What does it mean that energy is neither created nor destroyed
    7·2 answers
  • What type of substances are commonly transported into cells by channel proteins?
    14·1 answer
  • · cell membranes
    10·1 answer
  • how are radioactive isotopes used to determine the absolute age of igneous rock name to radiometric methods that are used
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following is not a nutrient needed by the body?
    14·1 answer
  • Which discovery best supports the hypothesis that evolution of the lactase-persistence trait was driven by dairying, the use of
    6·1 answer
  • Which effect could a mutation in mRNA have on the production of proteins?
    13·1 answer
  • Identify the principle role of cellular respiration
    13·1 answer
  • Which of the traits below are unique to animals?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!