1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
9

The way a rock reflects light is called the rock’s ____.

Biology
2 answers:
vodka [1.7K]3 years ago
8 0

Answer: refraction I think

Explanation:

vesna_86 [32]3 years ago
6 0

Answer:

Luster

Explanation:

You might be interested in
How do you calculate magnification on a light microscope?
aniked [119]

Answer:

In order to ascertain the total magnification when viewing an image with a compound light microscope, take the power of the objective lens which is at 4x, 10x or 40x and multiply it by the power of the eyepiece which is typically 10x.

5 0
3 years ago
What happens when blood glucose levels are high
romanna [79]

Answer:

not a question!

Explanation:

5 0
3 years ago
Read 2 more answers
What is not a possible indicator of a biological agent? select one: abandoned spray devices unusual number of sick or dying peop
Leona [35]
I think the correct answer from the choices listed above is the third option. It is an outbreak of psoriasis  that is not a <span>possible indicator of a biological agent. Hope this answers the question. Have a nice day. Feel free to ask more questions.</span>
3 0
3 years ago
Read 2 more answers
BIG POINTS How can a single cell become a larger organism 4 to 7 sentences long.
velikii [3]

Answer:

the respective means of growth within an organism varies from organism to organism. For instance, multicellular organisms grow via a process of cellular division known as mitosis, while others (being unicellular) grow or reproduce colonially-speaking via a process called binary fission.

Explanation:

Hope this helps!!

4 0
3 years ago
Which line, or band, represents the smallest dna fragment?
love history [14]
During electrophoresis, the fragment that travelled the furthest will be the smallest one. So if it's coming from top to bottom, then the band closest to the bottom will be the smallest one.
8 0
3 years ago
Other questions:
  • Your respiratory muscles contract each time you exhale.<br><br><br> TrueFalse
    5·1 answer
  • As observed in labrador retriever coat colors in recessive epistasis, b locus regulates pigment production while e locus regulat
    8·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Populations of blue-winged warblers, a type of bird, migrate south in the winter and return to Canadian breeding grounds in the
    8·1 answer
  • Psychological stress can increase a person’s susceptibility to disease.
    6·2 answers
  • The importance of the mind as a part of the body is an example of:
    11·2 answers
  • Classification is the method by which scientists name animals
    11·1 answer
  • Can someone help me please
    6·2 answers
  • Theme is the _____ or _____ about _____ that is communicated by a literary work.
    15·1 answer
  • What do economists call the inverse relationship between price and quantity demanded?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!