1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inna [77]
3 years ago
15

What are two parts of sexual reproduction that produce genetic variation

Biology
1 answer:
forsale [732]3 years ago
3 0

Answer:

  1. Independent assortment of chromosomes
  2. Crossing over

Explanation:

Independent assortment of chromosomes

We each have a diploid genome that is used to make haploid gametes. The selection of which combinations of chromosomes (and the particular alleles they hold) that are passed on to the gametes is random. I.e. 1 gamete could have the paternal chromosomes 1, 4, and 6, and maternal 2, 3 and 5. Another gamete could have paternal 2, 4, and 6, and maternal 3 2 and 5.

This produces unique combinations of alleles that are passed onto the next generation after sexual reproduction.

Crossing over

Crossing over occurs when homologous chromosomes pair up and align during meiosis. When this happens, they can exchange genetic material at homologous sites. This means that even <em>within </em>chromosomes, there are new combinations of alleles being created to pass on to the gametes before sexual reproduction. That is, each chromosome will have chunks of maternal and chunks of paternal DNA.

Both of these features increase genetic variation by two mechanisms, and this is occurring in two individuals, producing genetically diverse offspring.

You might be interested in
Areas where tectonic plates meet up but do not fit neatly into a category, and are ill-
jeka94

Answer:

Plate boundary zones.

Explanation:

  • Plate boundary zones are the interaction between adjoining plates where they clash, pull separated or slide past each other.
  • These newly created zones can be a long stretch from few kilometers to hundreds of kilometers.
  • It is the movement between two plates and the distortion that come about in the boundaries of the zone between the plates, which has given birth to New Zealand's geography which we see it today.
  • The distortion and mashing caused by the hit of the two great plates have created mountain ranges throughout the country.
3 0
2 years ago
The endocrine system regulates the body through hormone release. Like the nervous system, what does the endocrine system help ma
Oliga [24]

Answer:

How is the endocrine system related to the nervous system in terms of its regulatory activity?

For one, the endocrine system uses chemical signaling (hormones, produced by glands) while the nervous system uses electrical signaling (neural impulses). The signal transmission of the nervous system is fast because neurons are interconnected, but the functions are more short-lived.

Explanation:

5 0
3 years ago
Once sperm cells are mature and capable of fertilizing an egg they are stored for delivery in this part of the male reproductive
telo118 [61]
The answer is epididymis.
Epididymis is a tightly coiled mass of thin tubes that carries sperm from the testes to the ductus deferens in the ale reproductive system. Sperms matures as they pass through the epididymis so that they are ready to fertilize ova by the time they enter the ductus deferens.  During the ejaculation stage of emission sperms are moved from the testes and the epididymis, where they are stored, to the beginning of urethra. 
3 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Question 3 of 10 As in mitosis, in meiosis the chromosomes first become visible in
wolverine [178]
The answer to your question would be letter D
7 0
2 years ago
Other questions:
  • What is the malthusian limit<br>​
    5·1 answer
  • Which of the following genotypes indicates a homozygous dominant trait?
    5·1 answer
  • How are viruses harmful to host cells
    13·2 answers
  • Most heritable differences are due to
    10·2 answers
  • Decomposer serve a key role in the nitrogen cycle primarily because they
    7·2 answers
  • On the Galapagos one of the members of the founder species of finches was born with a larger beak than the others. This advantag
    12·2 answers
  • Emily went to the river and collected a small sample of water. When she returned home, she
    15·1 answer
  • What sentence should be capitalized
    5·1 answer
  • Where does transcription take place in the cell
    15·1 answer
  • In vertebrates, which structure frequently serves as the first intermediary between the areas of the brain that perceive sensory
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!