Is interphase....... Hope its right
Oxygen Depleting can cause Warm water. During summer, The upper layer of the water is lighter therefore it does not mix with the cooler water below. Which soon becomes stagnant. (Oxygen becomes depleted and toxic compounds may produce).
That is one of them. I hope it helps. I'm not so good when it comes to this type of science. But if you ever need help with Anatomy Or anything similar to that. I will gladly help.
DNA stores the instructions (genetic information) used to build proteins.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.
