1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Debora [2.8K]
3 years ago
5

Why does each replication fork require both leading and lagging strand synthesis?

Biology
1 answer:
GrogVix [38]3 years ago
7 0
A and d
the DNA is semi conservative
and the DNA pol always synthesize from 5’ to 3’
You might be interested in
A zygote forms when a sperm cell penetrates and fertilizes an egg. <br> a. True<br> b. False
Georgia [21]

Answer:

the answer is true. a zygote does

4 0
3 years ago
Which of Mendel's laws or principles states that gametes carry one allele for each trait?
Fed [463]

C. Law of segregation is the Mendel's law that states that gametes carry one allele for each trait.

8 0
3 years ago
Read 2 more answers
Which type of molecule that can be found in living things lacks carbon atoms
WARRIOR [948]
It is an organic substance.
6 0
3 years ago
Summers that are hot, humid, and rainy, winters that are below freezing with a lot of snow, 50-100 frost free days/year, and pre
Alex73 [517]

The correct option is D.

The Taiga biome, which is also known as the coniferous forest has been described as the largest terrestrial biome because it extends across some continents of the world. The biome typically has short summers, which can be very wet and winters, which are long and can be very cold. The majority of plants in taiga biome are conifers and these plants are described as ever green because they remain green all year round.

6 0
3 years ago
Read 2 more answers
Which of the following accurately compares nearsightedness and farsightedness? (1.0 points)
Kisachek [45]

Answer:

C

Explanation:

Nearsightedness is what happens when the image does not reach the retina whereas farsightedness happens when light is focused beyond the retina.

7 0
3 years ago
Other questions:
  • An industry dumps waste in an area adjacent to where minorities reside. what is this practice called?
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • -. In which phylum does a coelom first appear?
    12·1 answer
  • Based on the diagram which statement describes sexual reproduction?
    10·1 answer
  • Short note sentence describe the terms pure culture and mixed culture​
    10·1 answer
  • Why is air circulation important for photosynthesis to function properly?
    11·1 answer
  • The population of the United States is aging.<br> O True<br> O False
    7·2 answers
  • Yang is an agriscientist seeking to protect crops against pests. He selects plants that have shown a resistance to these pests.
    8·1 answer
  • True or False: The cells produced by the cell cycle are identical to each other.
    13·1 answer
  • Increases and decreases of the heart rate result from changes in the activity of the _______. A. medulla oblongata B. thalamus C
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!