1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horrorfan [7]
4 years ago
7

Which of the following is nicknamed the “powerhouse “ of the cell ?

Biology
1 answer:
lakkis [162]4 years ago
5 0

Mitocondria is nicknamed the powerhouse of the cell,  These structures are nicknamed the powerhouse of the cell because they work to convert energy into forms that the cell is able to use. Mitochondria are semi-autonomous cells, which means that they only rely partly on the cell for division and growth.

-www.reference.com/science/powerhouse-cell-f9bbce99417d7167

You might be interested in
How do you fit into a food web ? Describe a food web that includes you ?
sleet_krkn [62]

Answer:

We would be considered as one of the top predators.

Explanation:

There aren't many threats to humans at this point. We're omnivores, so we consume plants and meat. Humans are usually tertiary consumers, on the third trophic level, but sometimes can be on the second trophic level depending on the diagram.

8 0
3 years ago
What would happen if decomposition did not occur?
kifflom [539]
There would be things everywhere because it didn't decompose ex. orange peels, banana
6 0
4 years ago
When a label says that a food has 20 amino acids what are they really trying to say?
Kay [80]

it contains proteins

6 0
3 years ago
The function of pure lines: ?
MrRissso [65]

Answer:

The definition of a pure line is a result of inbreeding where animals or plants have certain characteristics that are the same through generations. An example of a pure line is the result of inbreeding of a certain flower to help it fight off diseases.

6 0
3 years ago
The chart below shows some information about two scientists.
ivann1987 [24]

Answer:

the answer is B i did this test

Explanation:

6 0
2 years ago
Other questions:
  • Which process is represented
    14·1 answer
  • Explain how sulfur impurities in coal can lead to increased acidity in rainwater and to the subsequent
    6·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A certain species of bacteria, Halobacterium, has a photosynthetic membrne that is colored purple. Its photosynthetic action spe
    12·1 answer
  • Compounds like the pesticide DDT may bring about the evolution of new strains of organisms by...?
    11·1 answer
  • What is the xylem? And what is the function of the xylem for grade 8's? (Please make it simplified)
    5·1 answer
  • Whats the flow of energy to killer whales in this image
    5·2 answers
  • Which of these treats malaria?
    14·1 answer
  • An __________________________ is caused by rock breaking under the surface of Earth and releasing energy that causes Earth to sh
    12·1 answer
  • How is photosynthesis related to changes in the amount of atmospheric carbon
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!