1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
12

What is DNA made of?

Biology
1 answer:
kicyunya [14]3 years ago
8 0
DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar<span> group, and a </span>nitrogen base<span>. The four types of nitrogen bases are </span>adenine<span> (A), </span>thymine (T), guanine (G) and cytosine<span> (C). The order of these bases is what determines DNA's instructions, or genetic code.</span>
You might be interested in
The water, coral, plants and animals that live in a coral reef is what level of organization
Likurg_2 [28]
The level of organization is plants, coral and water. Water came first.
6 0
3 years ago
Lower-body obesity significantly increases one's risk for chronic disease. lower-body obesity significantly increases one's risk
balandron [24]
The awnser would be false 
3 0
4 years ago
Researchers are studying lichens growing on trees in a forest
vesna_86 [32]

Answer:

The answer is A. Most lichen species are unaffected by the forest fire

7 0
4 years ago
Continuous cell lines differ from primary cell lines in that question 12 options:
Sholpan [36]
Continuous cell lines differ from primary cell lines in that <span>continuous cell lines are derived from primary cell lines.</span>
3 0
3 years ago
Which of the examples below illustrates a homologous body structure?
AlladinOne [14]

The forearm of birds, reptiles, and humans illustrates a homologous body structure.

  • Similar physical characteristics found in species with a shared origin are known as homologous structures, although these characteristics have entirely different biological purposes.
  • The limbs of humans, cats, whales, and bats are examples of homologous structures.
  • All of these structures—arm, leg, flipper, and wing—are supported by the same type of bone structure.
  • The arms of a person and the wings of a bat are excellent examples of homologous structures. Because both bats and people are mammals, they have a common ancestor.
  • Even though they appear considerably different from one another from the outside, a bat's wing and a human arm have remarkably comparable internal bone structures.
  • Wings help bats fly, whereas arms enable human interaction with their environment. The wing and the arm also have various purposes.

learn more about homologous structures here: brainly.com/question/7904813

#SPJ1

3 0
2 years ago
Other questions:
  • Natural influences in the Tundra Biome
    14·1 answer
  • Make an inference about what happens to the matter and energy during the formation and breakdown of a complex carbohydrate molec
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Articular cartilage of a long bone is found Select one: a. on the outer surface of the epiphyses. b. inside the medullary cavity
    8·1 answer
  • State three things that DNA and RNA have in common
    9·1 answer
  • Walter Sutton investigated the number of -------- in grasshoppers.
    8·1 answer
  • A scientist isolated a molecule with nucleotide bases A, C, G, and U and ribose sugars. What is it?
    9·1 answer
  • A neap tide is when the tides have a big difference between high and low tide. *
    12·1 answer
  • Would the world die off slowly or fastly if she died out?
    9·1 answer
  • 1.What might happen to the Spotted and Barred Owls if humans don't interfere?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!