<span>Cyanosis alludes to somewhat blue staining of skin, nail informal lodging layers. Ordinarily, hemoglobin conveys the majority of the oxygen in the blood. This oxygen conveying limit of hemoglobin in the blood is called oxygen saturation.</span>
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
The urinary system is made up of the kidneys, bladder and ureters (tubes that connect the kidneys to the bladder). The kidneys act as filters removing extra fluid and waste from your blood to make urine. Urine passes from the kidneys into the ureters, which drain into the bladder. When the bladder is full, urine flows out of the body through a tube called the urethra.
The ureters normally enter the bladder at a diagonal angle and have a special one-way valve system that prevents urine from flowing back up the ureters in the direction of the kidneys. If this system doesn’t work, urine can flow back towards the kidneys. This is called vesicoureteric reflux (also known as urinary reflux).
Sometimes vesicoureteric reflux (VUR) can be associated with other 'plumbing' problems in the urinary tract and with small, damaged or malformed kidneys.
So I believe the answer is 1.
It would way 100kg its half of the grams
Shelter food water and homeostasis
