1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
3 years ago
7

Compare homologous and analogous structures

Biology
1 answer:
olga55 [171]3 years ago
6 0

Answer:

Homologous structures can be described as the structures which are similar to one another present in different organisms. These similarities depict that the organisms might have a common ancestor i the past. For example, the forelimb of man, birds, dogs.

Analogous structures can be described as structures in different organisms which perform the same function but might not have a common origin. For example, the wings of bats and birds.

You might be interested in
How do the population in an ecosystem depend on each other
BabaBlast [244]
Dominate animals hunt the smaller and weaker animals for survival.
3 0
4 years ago
The giant short-faced bear disappeared completely from North America about 12 million years ago due to competition from smaller
Olin [163]
The answer is C hope it helps 
7 0
3 years ago
Read 2 more answers
What is the answer to 1c?
Semenov [28]

Answer:

because it can

Explanation:

there is no need to explain

8 0
3 years ago
Read 2 more answers
During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a G of -20 kcal/mol. If you double the amount
luda_lava [24]

Answer:

-20 kcal/mol (It stays the same)

Explanation:

Enzymes will reduce the Gibbs free energy of activation, but will neither increase or decrease the free energy of reaction.

Enzymes means of activity is by decreasing the activation energy (Ea or ΔG✳) for a reaction. This in turn raises the reaction rate.

Free energy of reaction

= free energy of product - free energy of substrate

The free energy of the product remains constant even without the enzyme. Hence, the enzyme would show no effect on the free energy of the reaction.

The attached image shows the effect of changes in enzyme concentration on the free energy.

5 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Considering the primary target organs of growth hormone, explain why growth hormone is not a tropic hormone
    5·1 answer
  • An ocean boarding Western Europe, Westin Africa, antarctica, and Eastern north and South America
    10·1 answer
  • Sometimes lymph nodes must be surgically removed. Although more lymph vessels eventually grow, what result would you expect to s
    5·1 answer
  • Choose all the answers that apply. The mantle _____. is the thinnest layer is the thickest layer is the hottest layer is made of
    9·1 answer
  • 1. Which sign is NOT for a chemical change?
    6·2 answers
  • A gene that is normally transcriptionally active can be "silenced" if it is relocated (through experimental manipulation) to cer
    14·1 answer
  • Owls eat voles ( a relative of mice ); voles eat grass and seeds . Which food chain is correct ?
    12·1 answer
  • Which is likely to be the first organisms to colonize an area after an disturbance like fire?
    14·1 answer
  • What are the consequences to utilizing DNA technology in medicine? Check all that apply.
    8·1 answer
  • A cell is placed in a hypertonic solution which of the following describe
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!