1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksenya-84 [330]
3 years ago
10

When pink snapdragons are crossed with white snapdragons, what color will the offspring be?

Biology
2 answers:
UNO [17]3 years ago
7 0
The correct response is C. Pink and white flowers, because upon crossing 2 pink snapdragons assuming incomplete dominance, with white snapdragons 50% of the flowers are pink snapdragons and the other 50% are white snapdragons.
wel3 years ago
4 0
When pink snapdragons are crossed with white snapdragons, the color of the offspring will be pink and white flowers. 
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
A nurse observes a 10-month-old infant chewing on the security alarm attached to his identification bracelet. the nurse should:
horrorfan [7]
The answer to this question would be: 3. distract the infant with a more appropriate toy.<span>
An infant wouldn't understand the instruction given by the nurse. It is more appropriate to give the infant another toy to distract him/her from the bracelet. The </span>identification bracelet is important to make sure that a procedure is done for the right patient and shouldn't be removed before the admission is over.
3 0
3 years ago
____ is a layer of fat cells that insulates most axons and speeds up the transmission of nerve impulses.
Virty [35]
The myelin sheath is the layer of fat cells that insulates most axons and speeds up the transmission of nerve impulses.
3 0
3 years ago
What is the expected percent change in the DNA content of a typical eukaryotic cell as it progresses through the cell cycle from
Anastasy [175]

The question is incomplete. The complete question is:

Question: What is the expected percent change in the DNA content of a typical eukaryotic cell as it progresses through the cell cycle from the start of the G1 phase to the end of the G2 phase

a. -100%

b. -50%

c. +50%

d. +100%

Answer:

d. +100%

Explanation:

S phase comes between G1 and G2 phases of the interphase of a cell cycle. S phase of interphase includes replication of DNA. The process of DNA replication doubles the amount of DNA present in the cell. The newly synthesized DNA is accommodated in the sister chromatids of chromosomes. Therefore, a cell with 2C DNA in the G1 phase would have 4C DNA at the end of the G2 phase. So, there is a +100% increase in the DNA content of a cell as it proceeds from G1 to the end of the G2 phase.

7 0
2 years ago
Being interested in penguins, Paul wanted to study the effect of fast food hamburgers on the weight of penguins. After many tria
iragen [17]

The experiment conducted by Paul was not a waste of his time and resources even though he could not accomplish the experiment he initially prepared to conduct. The reluctance of the penguins to eat burgers even though they were starving and losing weight pointed towards the fact that they do not find junk food appealing. It could be concluded from their reluctance that they will eat only their normal diet rather than something they have never eaten before.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following has the longest life
    7·1 answer
  • Is there such thing called a catchy and fast rhythm or is it a catchy and fast beat ???
    7·2 answers
  • A 54 year-old female with uncontrolled type 1 insulin dependent diabetes and related peripheral vascular disease presents with a
    11·1 answer
  • Originally a prodigy on the clarinet, _________ left New Orleans in 1914 to see the world and by 1919 he was touring Europe. He
    7·1 answer
  • Expressed traits of an organism?
    9·1 answer
  • Which feature or property of water allows plants to draw liquid water up from their roots?
    11·2 answers
  • What is a light year?
    6·1 answer
  • How would mutations affect the production of amino acids and therefore proteins?​
    8·1 answer
  • A population _______ follows a period of ________.
    13·1 answer
  • A compound in cranberries may prevent some bacteria from clinging to the urinary tract and help prevent urinary tract infections
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!