1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
9

The major function of the placenta is to

Biology
2 answers:
beks73 [17]3 years ago
6 0

Answer:

(2) exchange food, oxygen, and waste between

mother and fetus

Explanation:

In most mammals like humans, the fetus produced as a result of the fertilization of the sperm and egg, develops in the uterus or womb of the female. However, this developing fetus cannot yet fend for what it requires for survival and is still dependent on the mother e.g nutrients, oxygen etc. How do this substances get to the fetus? Here comes the role of the PLACENTA.

Placenta is an organ in the uterus that serves as a connection between the mother and the fetus in her womb. The placenta enables the mother to pass digested nutrients to the fetus and exchange gases (oxygen and Carbondioxide) between them via the umbilical cord. The placenta also enables the mother remove waste produced by the fetus into her bloodstream.

Paul [167]3 years ago
6 0
The answer is 2) The major function of the placenta is to exchange food, oxygen, and waste between mother and fetus.
You might be interested in
Sort the descriptions into the appropriate bins, which illustrate the types of biaxial movement.
Scrat [10]
I found the exercise on the internet. Attached is the descriptions and the bins.

Biaxial movement in a condylar joint:
-Example of knuckle joints
-Condylar type of joint

Biaxial movement in a saddle joint:
-Example of carpometacaral joint of the thumb
-Saddle type of joint
-Concave and convex surfaces displayed

Biaxial movement in both types of joints:
-Flexion permitted
-Extension permitted
5 0
3 years ago
What happens when a neurotransmitter binds to a receptor on the postsynaptic cell?
Grace [21]
<span>After release into the synaptic cleft, neurotransmitters interact with receptor proteins on the membrane of the postsynaptic cell, causing ionic channels on the membrane to either open or close. When these channels open, depolarization occurs, resulting in the initiation of another action potential</span>
3 0
3 years ago
Read 2 more answers
What type of fog is upslope fog?
xz_007 [3.2K]

Upslope fog forms when moist air is going up the slope of a mountain or hill (orographic lifting) which condenses into fog on account of adiabatic cooling, and to a lesser extent the drop in pressure with altitude

4 0
2 years ago
which piece of DNA would have the highest tm one with a cytosine plus guanine comment at t 30% or a cystonie plus guane content
erik [133]

Answer:

50% G+C will have a higher Tm

Explanation:

The Temperature of Melting (Tm) refers to the temperature at which 50% of double-stranded DNA (dsDNA) is changed to single-standard DNA (ssDNA). In the double helix of DNA, Adenine bases always pair with Thymine bases through two hydrogen bonds, whereas Guanine bases always pair with Cytosine bases through three hydrogen bonds. In consequence, a DNA molecule containing a higher GC content is more stable than another DNA molecule containing a lower GC content. The Tm can be calculated as follows = 2 °C(A + T) + 4 °C(G + C) = °C Tm (this equation is useful for oligonucleotides of 14 to 20 base-length).

6 0
2 years ago
The air density is so low in this layer of Earth's atmosphere that this is the location we normally think of as the start of out
Nutka1998 [239]

The answer is C because you have to know the outshell of the layers and the temperture

3 0
2 years ago
Other questions:
  • Describe the structures and functions of the enteric nervous system:
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A store manager timed Janette to see how long it would take her to fold and put away a sweater, a shirt, a pair of pants, and a
    9·1 answer
  • A scientist collects a spore from a new species of fungus and observes that this spore has a flagellum. What does the presence o
    7·2 answers
  • Given that transcription — the production of mRNA — requires a DNA template, where do you think this process occurs in the cell?
    7·1 answer
  • What three materials make up many viruses
    9·2 answers
  • What is pasteurization? what is the advantage of this technique?
    11·1 answer
  • What is a theory <br> tectonic plate
    7·1 answer
  • What is evolution?
    12·1 answer
  • which kingdom consists of organisms that can be classified as either plants-like,fungi-like,or animal-like ?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!