1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
13

Which process includes glucose and oxygen as reactants?

Biology
1 answer:
WARRIOR [948]3 years ago
5 0
Oxygen and glucose are both reactants in the process of cellular respiration.

I hope that this helps you !
You might be interested in
6. A single covalent bond forms when two atoms do which of these?
Sonja [21]

Answer:

B

Explanation:

4 0
3 years ago
To minimize negative environmental, impact a community should
Alex Ar [27]
Set policy after considering both the risks and benefits involved in building a toxic waste site within its boundaries
4 0
4 years ago
Read 2 more answers
i need someone that knows history and everything about slavery to repsond ASAP will give branliest for the best answer
Alborosie

Answer:

i know some whatcha need?

Explanation:

8 0
3 years ago
Select all of the factors that may have prevented the solid line from continuing to increase.
Eduardwww [97]
There is no image or attachment to your question. To have better success with receiving answers, attach an image regarding your question.
3 0
3 years ago
What is the purpose of medical ethics?
soldi70 [24.7K]
The answer is is third option
5 0
3 years ago
Read 2 more answers
Other questions:
  • The sun’s surface is made up mostly of _____.
    5·2 answers
  • What is the difference between an explanatory (or independent) variable and a response (or dependent) variable
    13·2 answers
  • How are human activities disturbing carbon dioxide levels and affecting marine life ?
    14·1 answer
  • During the cretaceous period, reptiles were the dominant species, and dinosaurs ruled earth. plants developed flowers and fruits
    15·2 answers
  • Which skin function is not correctly matched with the structure that accounts for that function?
    8·1 answer
  • 1. What is the name of a cell that does not have a nucleus or any membrane-
    12·2 answers
  • Sperm and ova are known as _______, and when they fuse they form a(n) _______. a) undifferentiated cells; zygoteb) zygotes; embr
    10·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which of the following would be an example of adaptation through natural selection?
    12·2 answers
  • During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!