1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
7

Can you please help me

Health
1 answer:
mars1129 [50]3 years ago
4 0

i can help if you zoom in and re post it otherwise i don't know how to zoom in on my computer

You might be interested in
What is hahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahaha
OlgaM077 [116]

Answer:

it is hahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahahaha

Explanation:

4 0
4 years ago
All of the following are important reasons to begin CPR immediately except:
Keith_Richards [23]

Answer:

I think its the blood oxygen levels

Explanation:

7 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
what are some of the concerns that medical professionals have about flu pandemics? What dangers do flu pandemics have?
kobusy [5.1K]
One of the biggest concerns in doctors that I have seen from watching TV is that flu pandemics if left untreated can turn deadly not within a matter of days but within a matter of minutes. Hope this helped.
7 0
4 years ago
Read 2 more answers
What is a designated driver?
algol13

Answer:

its a selection of a person who remains sober as the responsible driver. While the other person can drink alchohol in the car.

Hope this helps!

4 0
3 years ago
Other questions:
  • What should you do when planning outdoor activities?
    13·2 answers
  • Infant intelligence test scores often do not reflect true abilities because
    14·1 answer
  • What percentage of North American adults may be functioning below their potential due to prolonged exposure to stress? 
    13·2 answers
  • Matter is ______.
    9·2 answers
  • How many areas in the brain are associated with seeing?<br> 2<br> 30 <br> 42<br> 19
    8·1 answer
  • Testes is a male organ that makes_____<br>..???​
    10·2 answers
  • Which information can be accessed through a patient portal?
    8·2 answers
  • Which statement is true regarding the effect of physical activity on your recovery heart rate?
    6·2 answers
  • Identify Two ways how you could improve your self- awareness. ​
    8·1 answer
  • The ________ describes a shift in the patterns of morbidity and mortality from primarily infectious diseases to primarily chroni
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!