1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sdas [7]
3 years ago
13

What is the “main sequence” refer to

Biology
1 answer:
Allushta [10]3 years ago
3 0
<span>Hello, to answer your question. The main sequence is a continuous and distinctive band of stars that appears on plots of stellar color versus brightness

       Signed by, Virtuoso Sargedog</span>
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Please respond!!!
kodGreya [7K]

Answer:

this may help

"The presence of hair, composed of the protein keratin, is one of the most obvious characteristics of mammals. Although it is not very extensive or obvious on some species (such as whales), hair has many important functions for most mammals. Mammals are endothermic, and hair traps a boundary layer of air close to the body, retaining heat generated by metabolic activity. Along with insulation, hair can serve as a sensory mechanism via specialized hairs called vibrissae, better known as whiskers. Vibrissae attach to nerves that transmit information about tactile vibration produced by sound sensation, which is particularly useful to nocturnal or burrowing mammals. Hair can also provide protective coloration or be part of social signaling, such as when an animal’s hair stands “on end” to warn enemies, or possibly to make the mammal “look bigger” to predators.

Unlike the skin of birds, the integument (skin) of mammals, includes a number of different types of secretory glands. Sebaceous glands produce a lipid mixture called sebum that is secreted onto the hair and skin, providing water resistance and lubrication for hair. Sebaceous glands are located over most of the body. Eccrine glands produce sweat, or perspiration, which is mainly composed of water, but also contains metabolic waste products, and sometimes compounds with antibiotic activity. In most mammals, eccrine glands are limited to certain areas of the body, and some mammals do not possess them at all. However, in primates, especially humans, sweat glands are located over most of the body surface and figure prominently in regulating the body temperature through evaporative cooling. Apocrine glands, or scent glands, secrete substances that are used for chemical communication, such as in skunks. Mammary glands produce milk that is used to feed newborns. In both monotremes and eutherians, both males and females possess mammary glands, while in marsupials, mammary glands have been found only in some opossums. Mammary glands likely are modified sebaceous or eccrine glands, but their evolutionary origin is not entirely clear.

The skeletal system of mammals possesses many unique features. The lower jaw of mammals consists of only one bone, the dentary, and the jaw hinge connects the dentary to the squamosal (flat) part of the temporal bone in the skull. The jaws of other vertebrates are composed of several bones, including the quadrate bone at the back of the skull and the articular bone at the back of the jaw, with the jaw connected between the quadrate and articular bones. In the ear of other vertebrates, vibrations are transmitted to the inner ear by a single bone, the stapes. In mammals, the quadrate and articular bones have moved into the middle ear ((Figure)). The malleus is derived from the articular bone, whereas the incus originated from the quadrate bone. This arrangement of jaw and ear bones aids in distinguishing fossil mammals from fossils of other synapsids.

Mammals, like birds, possess a four-chambered heart; however, the hearts of birds and mammals are an example of convergent evolution, since mammals clearly arose independently from different groups of tetrapod ancestors. Mammals also have a specialized group of cardiac cells (fibers) located in the walls of their right atrium called the sinoatrial node, or pacemaker, which determines the rate at which the heart beats. Mammalian erythrocytes (red blood cells) do not have nuclei, whereas the erythrocytes of other vertebrates are nucleated. "

Explanation:

7 0
3 years ago
1. How do disturbances (or catastrophes) affect ecological succession? Be as specific as possible. Right answers only.
tino4ka555 [31]

Answer:

There are two types of ecological succession:

Primary succession:

Primary succession occurs in areas which were previously devoid of life. There were no organisms living in this area before. For example, lands after new glaciers or volcano  eruptions. Firstly, microorganisms begin to habitat this land, followed by plants like lichens, shrubs etc. Finally, complex life evolved from these.

Secondary succession:

Secondary succession arises in areas where life existed before but was destroyed due to natural circumstances like flood, fire etc. Small grasses inhabit this land first which are taken over by trees over  period of time.

3 0
3 years ago
What do I do. Please help.
ycow [4]

you just label the transport of low protein levels

Explanaron:

8 0
2 years ago
Where does all energy ORIGINALLY come<br> from?
labwork [276]

Answer:

the sun

Explanation:

8 0
3 years ago
Other questions:
  • What eats turkey vultures
    10·1 answer
  • The advantage of yeast cells over bacterial cells to express human proteins is that:
    6·1 answer
  • Select all that apply.
    11·2 answers
  • A biologist ground up some plant leaf cells and then centrifuged the mixture to fractionate the organelles. Organelles in one of
    8·1 answer
  • List two real landforms crated when tectonic plates calide
    5·1 answer
  • You discover a new species of ape that is more closely related to gorillas than to any other species of ape, but walks upright.
    8·1 answer
  • How are analog and digital information stored?
    15·1 answer
  • Which gland, classically referred to as the “master gland,” releases hormones that control the thyroid gland, adrenal glands, an
    14·2 answers
  • 3. Enzymes, which influence chemical reactions, are complex types of:*
    7·1 answer
  • Create a personal plan of preventative health and dental management. What steps can you take to maintain your health and wellnes
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!