1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VMariaS [17]
3 years ago
5

During an experiment a scientist observed prokaryotes that lived near volcanic vents deep in the ocean the scientist most likely

observed
A. Photoautotrophs
B. Chemoautotrophs
C. Heterotrophs
D. Photoheterotrophs
Biology
2 answers:
Natalija [7]3 years ago
4 0

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ The correct answer is B. Chemoautotrophs.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

Leona [35]3 years ago
3 0
The correct awnser is b .............................
You might be interested in
Many protists can move. what are some structures mentioned that can help protists move.
Ksivusya [100]

Answer:

cilli and flagella

Explanation:

I think there is one more but not sure hope this helped

(also if spelling is weird sorry I tried)

6 0
2 years ago
Living cells cannot use heat to provide the activation energy for biochemical reactions because ________. Which choice(s) comple
postnew [5]

Considering the following;

I. Heat is not readily available to all living cells.

II. Heat at excessive amounts denatures proteins.

III. Heat does not provide the activation energy for their reactions.

IV. When a critical temperature is reached, proteins no longer function

Answer;

I and IV

Explanation;

Living cells cannot use heat to provide the activation energy for biochemical reactions because heat is not readily available to all living cells and also when a critical temperature is reached, proteins no longer function.

Too much heat can kill an organism by rendering its organelles, cells, tissues and organs permanently inoperable and un-salvageable. The same process can be observed in tissues at low temperatures, and is the cause of frostbite. This is because enzymes are denatured by high temperature and inactivated by low.

7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Arpita is very fond of flowers. She visited her grandfather’s house and collected a Water Lily plant for her garden. Arpita plan
Ghella [55]
<h2>Answer:</h2><h3>Lilies do best in a position of full sun, ideally with their roots in rich and fairly moist, yet free-draining soil or compost. Grow oriental lilies in acidic soil or ericaceous compost, and Asiatic lilies in neutral to alkaline soil or multi-purpose compost and not in gardens because most Garden soils are made from three main components: clay, sand and silt. The ideal soil (or loam) has equal amounts of all three, making a fertile soil that is free draining and easy to dig.Which are nothing but making the sand more rougher.So therefore those lillies will not grow in the garden soil and that is the reason why the lillies never grew</h3><h3 />
8 0
2 years ago
Which of the following is a possible ancestor to modern humans? a. Australopithecine Afarensis b. Australopithecine Robustus c.
BARSIC [14]
According to science, D would be the correct answer. Hope this helps!
7 0
3 years ago
Read 2 more answers
Other questions:
  • What process causes your feet to feel hot when you walk on a hot surface
    8·1 answer
  • What sets diffusion apart from facilitated diffusion?
    5·1 answer
  • Differences between amino acids are normally due to differences in which part of the molecule?
    9·2 answers
  • 1.Are there any cures or medication to relieve the effect of the Alzheimer’S disease? If so, what are they
    9·1 answer
  • How did the research presented in the article affect scientists’ understanding of the evolution of eukaryotes.
    9·1 answer
  • Butterflies taste food by
    7·2 answers
  • What type of climate has no winters
    5·2 answers
  • How are meiosis and<br> mitosis different?
    7·2 answers
  • Please help me <br><br> 3. What is the difference between society and culture?
    15·1 answer
  • The cells of complex multicellular organisms are organized into structures. What is the order of these structures from the most
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!