1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zmey [24]
3 years ago
14

PLEASE HELP ME 100 POINTS AND BRAINLIEST

Biology
2 answers:
sammy [17]3 years ago
7 0

Answer:

This is an sex-linked dominant inheritance

Explanation:

The male dominate the female

LiRa [457]3 years ago
3 0

Answer:

This is an sex-linked dominant inheritance

Explanation:

You might be interested in
How do endocrine hormones reach their target cells?.
GuDViN [60]
Hormones are transported through the blood stream to target cells.
7 0
3 years ago
Certain elements, such as carbon and nitrogen, are recycled in nature and are released through the _________ of living things.
andrew11 [14]

Answer:

Decomposition

Explanation:

According to the carbon cycle when organisms die they decompose and release carbon.

Hope this helped!! :)

5 0
3 years ago
Read 2 more answers
When you are sick, your lymph nodes swell with extra erythrocytes. True False
pickupchik [31]
This is true.
I am or sure
5 0
3 years ago
There are the same amount of carbon atoms on Earth now as there were in the past, but there are more in the atmosphere ever befo
kupik [55]

The global average atmospheric carbon dioxide in 2019 was 409.8 parts per million (ppm for short), with a range of uncertainty of plus or minus 0.1 ppm. Carbon dioxide levels today are higher than at any point in at least the past 800,000 years.The carbon cycle describes the process in which carbon atoms continually travel from the atmosphere to the Earth and then back into the atmosphere. Since our planet and its atmosphere form a closed environment, the amount of carbon in this system does not change.

3 0
3 years ago
What is ultimate purpose of digestion
Mars2501 [29]

Explanation:

Digestion is important for breaking down food into nutrients, which the body uses for energy, growth, and cell repair. Food and drink must be changed into smaller molecules of nutrients before the blood absorbs them and carries them to cells throughout the body.

4 0
3 years ago
Other questions:
  • What are the three main zones of the open ocean?
    15·1 answer
  • When a scientist contrasts two or more objects what is he or she looking for
    6·1 answer
  • The branch of psychology that studies how a person's thoughts, feelings, and behavior are influenced by the presence of other pe
    13·1 answer
  • Which field of earth science seeks to understand why Jupiter's moon has so many active volcanoes?
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What was different about the atomic theory proposed by Niels Bohr?
    5·1 answer
  • What is science to you? like whats your own definition of science
    11·2 answers
  • Why adaptation is important for living beings​
    10·1 answer
  • A guy bikes 15 miles in 1 hour, then rests for an hour. Then he bikes 25 in 2 hours. What was his average speed for the trip?
    9·1 answer
  • The construction of wind farms has affected the migratory patterns of some bird populations. Bird populations have be noted to n
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!