Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
Robert Hooke discovered the microscope I'm not sure about the others
Answer:
I would believe the mesosphere would be the most difficult layer to breathe. Troposphere is where we are, ov we can breathe here, stratosphere would be hard to breath in as well
Answer:
C
Explanation:
When surface temperature of a star gets higher it gets lighter (white or blue(when it is hotter it gets more bluish)) since giants have less surface temperature they are yellow or orange, where dwarfs are white or blue.
So, they have different colors because they have different surface temperatures.
Continuous feeders are aquatic animals that constantly feed by having water filled with food particles (for example, small plankton or fish) entering through the mouth. In addition, they do not need a storage area, such as a stomach, for food. Now Discontinuous feeders must hunt for food on a regular basis; they need a storage area, such as a stomach, to house food until it is digested.
