1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Furkat [3]
3 years ago
15

A ________ is the space between two neurons where the axon of a sending neuron communicates with the dendrites of a receiving ne

uron by using chemical messages.
Biology
1 answer:
Arada [10]3 years ago
3 0

Answer: Synaptic gap

A synaptic gap is the space between two neurons where the axon of a sending neuron communicates with the dendrites of a receiving neuron by using chemical messages.

Explanation:

Neurons are joined end to end in a special way, the axon of one neuron forms a junction with the dendrites of the next neuron. However, the two neurons do not touch, but leave a gap called synaptic gap.

Thus, synaptic gap is the answer.

You might be interested in
Can someone please help me?
Veronika [31]
C 50%
cause one has a dominant thats guarantee dominant
5 0
4 years ago
The term used to identify identical strands of DNA held together by a centromere
givi [52]
<span>The two identical chromosomes that result from DNA replication are referred to assister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere.</span>
5 0
3 years ago
Choose all the answers that apply. Tall pea plants are dominant over dwarf pea plants. If two hybrids (Tt) are crossed _____. 50
stellarik [79]

Answer: 50% Tt, 25% short, 75% tall

Explanation: Tt x Tt —> TT  tt  Tt tT possible

proportions by genotype TT 25% Tt 50% tt 25%

T dominant so

proportions by phenotype tall (TT, Tt) 75% short (tt) 25%

8 0
3 years ago
Read 2 more answers
How does loseing laforin give you epilepsy ( please use lots of detail in the answer)
Deffense [45]
<span>Lafora disease is the most severe teenage-onset progressive epilepsy, a unique form of glycogenosis with perikaryal accumulation of an abnormal form of glycogen, and a neurodegenerative disorder exhibiting an unusual generalized organellar disintegration. The disease is caused by mutations of the EPM2A gene, which encodes two isoforms of the laforin protein tyrosine phosphatase, having alternate carboxyl termini, one localized in the cytoplasm (endoplasmic reticulum) and the other in the nucleus. To date, all documented disease mutations, including the knockout mouse model deletion, have been in the segment of the protein common to both isoforms. It is therefore not known whether dysfunction of the cytoplasmic, nuclear, or both isoforms leads to the disease. In the present work, we identify six novel mutations, one of which, c.950insT (Q319fs), is the first mutation specific to the cytoplasmic laforin isoform, implicating this isoform in disease pathogenesis. To confirm this mutation's deleterious effect on laforin, we studied the resultant protein's subcellular localization and function and show a drastic reduction in its phosphatase activity, despite maintenance of its location at the endoplasmic reticulum. 

I got my information from </span>https://www.ncbi.nlm.nih.gov/pubmed/14722920
4 0
3 years ago
PLEASE HELP 20 POINTS
Natasha_Volkova [10]

Answer:

When the meteor hit a caused a chain reaction which caused all that and made some cloud that was toxic.

Explanation:

6 0
3 years ago
Other questions:
  • Features of plant cells that clearly make them different from animal cells are
    12·1 answer
  • Which type of hearing problem can be reduced with ordinary hearing aids? central deafness conduction deafness sensory-neural dea
    11·1 answer
  • When a____ air mass moves toward a warmer air mass, it causes a cold front. The ____ air rises, leaving ____ temperatures in the
    14·2 answers
  • Richard is an avid gardener who spends a lot of time caring for the plants in his garden. To minimize damage from pests from his
    9·1 answer
  • Which group of chordates has a notochord and includes separate males and females?
    11·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • james suffers from atherosclerosis a condition that causes artery walls to harden and thicken atherosclerosis restricts blood to
    5·1 answer
  • Which chemcal bond most likely stores the most energy?
    11·1 answer
  • How much guanine is in a salmon
    14·1 answer
  • Humans decide which varations are favorable or desired.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!