Answer:
the second sentence and the 4th one
I really forgot this one but have a feeling its these ones if you know anymore information then i do combine the 2 information.
Explanation:
Answer:
1. The descendants are Blue whales, and Humans
2. Back bone Lungs , radius and ulna (front limb bones), structures for producing milk
Explanation: It points to the descendants of common ancestors to blue whales and humans, If not please tell me more clearly what you meant by descendants.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
your brain needs oxygen to think and your lungs need oxygen to live and keep your body going
Explanation:
i think not for sure tho
The water vapor which is the humdity. Rain. And less water on land.
