1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
3 years ago
11

Which of the following does not affect the final outcome of gene expression?

Biology
1 answer:
rewona [7]3 years ago
5 0
I am so positive it’s D because that’s the only one that makes sense. Trust me
You might be interested in
WARM-UP
Naddik [55]
It’s burning wood ,heating water,Roasting food
3 0
2 years ago
Cuántas cifras significativas tiene la siguiente cifra 9000?
xxMikexx [17]
<h2>Answer: Solo tiene 1</h2>

Explanation:

5 0
3 years ago
Explain how cells in your body benefit from having different systems work together
sasho [114]
Cells in your body work together, they form bones, and muscles. Cells, however cannot work alone, they must be able to work together. Each cell does a different thing.
3 0
2 years ago
Read 2 more answers
From 1787 until the passage of the 17th Amendment in 1913, Senate members were selected by __________.
Aleksandr-060686 [28]
The people of the united states
5 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Other questions:
  • Mass is expressed in what type of units
    7·2 answers
  • How and why heredity increases the diversity among organisms?
    15·2 answers
  • What do all complex multicellular organisms have in common? a means by which to hold cells together regulatory gene networks tha
    8·1 answer
  • Two plants are crossed, resulting in offspring with a 3 dominant:1 recessive phenotypic ratio for a particular trait. This ratio
    9·1 answer
  • Other than going through the same phases/ names, give 2 similarities between mitosis and meiosis
    15·2 answers
  • 4. Which of the following properties most determines water’s vertical position in the ocean?
    7·2 answers
  • Which of the following is true:
    10·2 answers
  • What happens to the glucose molecule during the process of cellular respiration?
    10·2 answers
  • 3. Jelaskan fungsi ragi atau bibit dalam proses pembuatan produk pangan bioteknologi konvensional tersebut! Unsur apakah yang te
    10·1 answer
  • Identify the parts of the nervous system.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!