1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
5

Willful muscle contraction; emotions

Biology
1 answer:
777dan777 [17]3 years ago
8 0
Its the frontal lobe. :)
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Sea turtles return to the same beach they hatched on
Galina-37 [17]
If it’s a true or false question, then this is true. their instincts allow them to return to the beach they originally hatched from
3 0
3 years ago
Read 2 more answers
In your own words, explain what natural selection is?
Katyanochek1 [597]

Answer:

Natural selection is the process of which forms of life having traits that better enable them to adapt to specific environmental pressures, such as predators, changes in climate, or even competition for food or mates. As the species will tend to survive and reproduce in greater numbers than others of their kind, thus ensuring the perpetuation of those favorable traits in succeeding generations.

3 0
3 years ago
Which definition best describes global warming?
Over [174]
B) A long time increase in the Earths Average temperature
8 0
3 years ago
Read 2 more answers
What characteristic do fossil fuels, soil, and sunlight all share?.
kondor19780726 [428]

Answer:

They are all natural resources. They are all renewable resources.

Explanation:

4 0
2 years ago
Other questions:
  • En las clínicas radiológicas existen letreros/ avisos que indican que las mujeres embarazadas o sospechan estarlo, antes de some
    8·1 answer
  • A student is studying the ecology of a playa lake, which forms after a rainfall in a dry lake bed. the table lists the organisms
    7·1 answer
  • how do current levels of plant and animal biodiversity on easter island compare with past biodiversity levels
    15·1 answer
  • The Golgi apparatus
    5·2 answers
  • A biologist wishes to take a useful gene found in pine trees and introduce it into some bacterial cells. Her experimental proced
    13·1 answer
  • Help me please its due in a hour
    14·1 answer
  • The diagram shows a plant cell before and after it is placed in a solution. After the cell is placed in the solution it changes
    11·2 answers
  • Archaea and Eubacteria are both forms of bacteria. Look at the short definitions of both of them. How are they different?
    7·2 answers
  • With incomplete dominance, a likely ratio resulting from a monohybrid cross would be ________. Group of answer choices
    7·1 answer
  • What are the importance of biology? give any two point​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!