1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
10

DNA codes for specific proteins. Why are proteins so vital to the human body? Provide a couple of examples.

Biology
2 answers:
Tpy6a [65]3 years ago
8 0

Answer:

they help us to grow

Explanation:

protein is a body building food

Veseljchak [2.6K]3 years ago
4 0

Answer:

-They do most of the work in cells

-They are required for the structure, function, and regulation of the body's tissues + organs

You might be interested in
Carbon transferring from a body of water to the atmosphere is called
AveGali [126]
Diffusion , the movement of gas molecules . 
3 0
3 years ago
Read 2 more answers
Which of the following is shared by both plant and animal cells?
Blizzard [7]
The answer is a)nuclei

7 0
3 years ago
Read 2 more answers
The majority of escapes from correctional facilities involve
Sever21 [200]
Involve probation/prison breaks
4 0
3 years ago
Which pair best matches a type of land cover with an appropriate land use?
shutvik [7]

b is the correct answer.

3 0
3 years ago
Read 2 more answers
List three reasons that snow predictions made by meteorologists are sometimes incorrect
mr Goodwill [35]

The conditions depend on the density level of the snow.

Another reason is the imperfect data gathering especially if initial results are only gathered.

The third reason is that computer models still find it difficult to see small scale phenomena.

8 0
3 years ago
Other questions:
  • An 18-year-old college student with an exacerbation of systemic lupus erythematosus (sle) has been receiving prednisone (deltaso
    8·1 answer
  • Tasha went on a trekking exposition to a mountain range during her vacation when she reached a particular height it started taki
    10·1 answer
  • 50 points!! please help rewrite this in your own words thank you!!
    10·2 answers
  • Structures that are similar due to common ancestry are called:
    5·1 answer
  • State Road 40 and several other roads run through the Ocala National Forest. For several years, forest rangers collected data sh
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Briefly explain why experiments having faulty design or inconsistent data are problems for scientists. List several reasons.
    6·2 answers
  • Pwease halp meh =w= <br><br> Im so dumb...
    15·1 answer
  • What is the ultimate energy for all life on earth
    8·2 answers
  • Darwin explained that all life came from ________________
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!