1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
12

Which trophies level contains the most energy?

Biology
1 answer:
AleksAgata [21]3 years ago
4 0

Answer:

producers

Explanation:

All the energy comes from the sun. a small amount of sunlight energy is trapped by green plants and used in photosynthesis to form organic materials in plants that are sources of food to the rest of the animals. Animals get  this energy when they feed on plants directly like the herbivores or indirectly like the carnivores.

You might be interested in
A forest was cleared to build a road. Which two would be the most likely effects on the ecosystem?
mihalych1998 [28]

Answer:

The new species will evolve to survive in the deforested land & animals will migrate to other regions in search of food.

Explanation:

8 0
4 years ago
Read 2 more answers
the nervous system that controls respiration is called autonomic because it a. uses nerves of the body. b. conducts impulses. c.
kati45 [8]
The term autonomic. Shows that it is an automatic system and so not controlled by the body the answer is C
5 0
4 years ago
Read 2 more answers
Matched chromosomes carrying information about the same characteristics in the organism are called _____ chromosomes.
torisob [31]
<span>Homologous (This means they are the same chromosome from each parnet, matched together) </span>
6 0
3 years ago
Read 2 more answers
22. Robert Hooke, a French scientist, published Micrographia in which he described many
Tasya [4]
False. I don’t know how to explain it
4 0
2 years ago
I need some help with spelling. Help me with the ones I haven't done yet and check my other answers. The word box is there
SSSSS [86.1K]
Interrupt, rupture
contradict, verdict
respect, import
deport, inspect, transport
This is what I got. I hope this helps :)



8 0
4 years ago
Other questions:
  • Tomas had low levels of calcium in his body. Vitamin D is essential in maintaining a calcium balance. He started taking vitamin
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Hardy-weinberg equilibrium is possible only if the population is:
    11·1 answer
  • How does the structure of DNA differ from the structure of RNA?
    10·2 answers
  • what are three questions that a physical oceanographer might try to answer in an investigation of El Niño?​
    14·1 answer
  • In which two places do divergent boundaries occur?
    11·2 answers
  • Can you tell me about the respiratory system in more detail?
    10·1 answer
  • CH3<br> CH2-CH2-CH-CH2-CH?<br> 1<br> 1<br> OH<br> Name the compound
    12·2 answers
  • angie's mom can roll her tongue will angie be more likely to have that ability or more likely not to have that ability ​
    7·1 answer
  • What is the thickest and longest nerve in the human body
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!