1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
3 years ago
15

After frida stops exercising she continues to breath heavily what is most likely to occur in her body

Biology
1 answer:
saveliy_v [14]3 years ago
3 0
Hey :)

Strenuous exercise has caused her body to be in oxygen debt, and she is breathing hard while lactate is transported to the liver. This is a result of anaerobic respiration. 

Hopefully this helped and good luck!!!
You might be interested in
Albinism (the total lack of pigmentation) is recessive (and really rare!) in humans. If an albino female marries a normal but he
lord [1]

Answer: not sure on the percentenge all i know is the albino gene is a recessive gene

Explanation:

5 0
3 years ago
12 points! Please answer!
notka56 [123]

Answer:

sedimentary rock

Explanation:

Sedimentary rocks are the type of rocks that formed by the deposition or accumulation of small mineral or organic particles on the floor of water bodies at the Earth's surface. some of the example of sedimentary rocks are Shale, limestone and sandstone.

Folding is common in areas of thick sedimentary rocks <em>due to deposition of several layers of particles over one another or slumping of sedimentary material before it is lithified.</em>

Hence, the correct option in sedimentary rock.

8 0
3 years ago
Help! I’m on a 7 question test and I cannot fail it!!!!!!!
Andreas93 [3]

Answer:

Uhhh how can I help?

Explanation:

4 0
3 years ago
Read 2 more answers
The ________ is the part of the eye that contracts and dilates to adjust the amount of light entering the pupil whereas the ____
daser333 [38]
Retna is what adjust and the pupils is what focuses on object s
7 0
4 years ago
I need help ASAP!! please!!
Katena32 [7]
The answer is C, neither the Hawaiian Islands or Mount St. Helen's were created by platonic pressure beneath the ocean. The Mid Atlantic Ridge was formed as the plates slid past each-other, causing on uprising, once again, under the ocean.
7 0
4 years ago
Other questions:
  • Some members of david's family have an autosomal recessive disease. david does not have the disease; neither do his parents, nor
    8·1 answer
  • Which of the following personal health conditions can be controlled by exercise and diet? A.Heart disease B.Sickle cell anemia C
    13·2 answers
  • Food examples of carbohydrates?help?
    11·2 answers
  • Whats similar between a suspension and a solution
    8·1 answer
  • Name and describe the phase change that occurs when solid carbon dioxide (dry ice) is placed in an open container at room temper
    14·1 answer
  • A species of fly has two alleles for the length of their legs. The allele for long
    10·2 answers
  • Please answers this 2 questions!!!
    9·1 answer
  • Which of the following is the best definition of a prokaryote?
    8·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 15. Explain how the tilt of the earth causes the seasons. *
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!