How does gravity put plant roots in the right place to help a plant live and grow (A). it helps roots move toward the light.

Biology

2 answers:

stiks02 [169]2 years ago

8 0

The answer is C, it helps the roots to down. Think of gravity, it keeps us in place

Zolol [24]2 years ago

7 0

The answer is C because we know it can’t be D and it not going to get air under ground so it must be C.

You might be interested in

1.______ from the sun is transferred to_____ surface. some of that energy is then _____

Ket [755]

1. Energy from the sun is transferred to earth's surface. Some of that energy is then transferred to the air above the surface.

2. The closer a location is to the equator the more energy it receives from the sun. Therefore a location's air temperature is affected by its distance from the equator.

3. An effect my have more than one cause. These may be linked into a chain of effects and causes.

7 0

2 years ago

The Great Oxygen Event marks the time, approximately 2.5 billion years ago, when ________.

Leokris [45]

Answer :There was enough oxygen in the atmosphere to support a major burst of life on Earth

Explanation:

The Great Oxygen Event marks the time, approximately 2.5 billion years ago, when there was enough oxygen in the atmosphere to support a major burst of life on Earth

For the first half of the Earht's history, there was no oxygen in the atmosphere. It was inhabited only by single-celled organisms.Of those simple life forms, the cyanobacteria may have. evolved a way to take energy from sunlight, and used it to make sugars out of water and carbon dioxide. They used the same chemical process we know as photosynthesis. This released vast quantities of oxygen into the atmosphere and triggered the evolution of complex life.

3 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein