All categories

3 years ago

GIVING BRAINLIEST! Help please!

2 answers:

6 0

When the ocean produces oxygen through the plants (phytoplankton, kelp, and algal plankton) that live in it. These plants then produce oxygen as a byproduct of photosynthesis, which is a process that converts carbon dioxide and sunlight into sugars that the organisms can use for energy then and later on.

Explanation:

cluponka [151]3 years ago

6 0

Coastal ecosystems gives aprox. 50% of the earth's oxygen. This is due to the variety of plants that live in their water, example of these are phytoplankton and algae

You might be interested in

What are the different characteristics of a single celled organism.

Setler79 [48]

 characteristics of single cellular organism :

all life processes are conducted by single cell
reproduces asexually 
generally have special projections for movement. eg. cilia in paramesium .
food and other substances are transported by diffusion

i hope it helped...

6 0

3 years ago

As you travel from the surface of the earth up through the atmosphere into outer space, the gases become.A) more dense.B) less d

IgorC [24]

B: less dense hope this helps

4 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Please Help Next to Mark’s house, there is a large meadow with small plants and no trees. Behind the meadow is a dense forest wi

Bumek [7]

The forest would be cooler because the trees are thick and no sunlight is allowed through. things are much cooler when there’s no sunlight allowed near them- think about the difference on a hot summers day sitting in unshaded grass vs sitting in shady grass under a big tree.

3 0

3 years ago

Explain the purposes of gene expression studies. Describe the use of DNA microarray assays and explain how they facilitate such

denis-greek [22]

Answer:

Both gene expression and DNA micro array study about the expression of gene during different stages of development.

Explanation:

The main purpose of gene expression studies is to determine the level of mRNA expressed at different stages of transcription in a tissue or at different stages of cellular development. If a gene is not “ON” during synthesis of RNA and protein, then the desired proteins are not produced. Such studies allow us to turn on such genes.

DNA microarray assays easily identify and determine the network of gene expression across the entire genome. The common application of DNA microarray include – mutation analysis and detection, assessment of gene cop, immunoassays etc.

4 0

3 years ago