1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
15

You can reduce the amount of pollutants in your home by _____.

Biology
2 answers:
Rina8888 [55]3 years ago
3 0

You can reduce the amount of pollutants in your home by improving air circulation.

lbvjy [14]3 years ago
3 0

Answer: Reducing the waste and reusing the materials that can be used.

Explanation: The amount of pollutants can be reduced in house by reducing the amount of waste.

The materials that can be reused has to be reused so that the total waste can be less than the normal.

The materials can be recycled to be used again like a broken flower vase can be recycled into a show piece.

You might be interested in
based on hierarchical organization, place the living systems in order from smallest to largest. blue wildebeest. blue wildebeest
Sunny_sXe [5.5K]

The correct answer is:

1 - Blue wildebeest (Connochaetes taurinus)

2 - Blue wildebeests

3 - Blue wildebeests and Black wildebeests

4 - Blue wildebeests, Black wildebeests, crocodiles, acacia trees

5 - Maasai Mara

A hierarchical organization is an organizational structure where every component of the organization is subordinate to some other component.


8 0
3 years ago
When new cells are formed through the process of mitosis what os the number of chromosomes in the new cells?
Fantom [35]
The number of chromosomes are 23

8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Why does incomplete dominance not support the blending theory of inheritance?
Nookie1986 [14]
Incomplete dominance can happen in flowers such as snap dragons where a red flower plant and a white flower plant have an offspring that is neither red nor white but is a mix so in this case it would be pink. It does not support the blending theory as it does not get its colour from the dominant plant in this case but from both.
5 0
3 years ago
Carbon dioxide is added to the atmosphere:
devlian [24]
B.
When fossil fuels are burned carbon dioxide is released in to the atmosphere
hope this helps
8 0
3 years ago
Read 2 more answers
Other questions:
  • The __________ valve is located between the right atrium and the right ventricle.
    5·1 answer
  • WILL GIVE BRAINLIEST!!!
    15·1 answer
  • Under which of the following conditions will speciation not occur?
    6·1 answer
  • Which of the following describes a community.
    8·1 answer
  • A 45 year old man had coronary artery stents placed 2 days ago. Today, he is in severe distress and reporting crushing chest dis
    9·1 answer
  • Which base is found only in RNA?<br> ribose<br> Othymine<br> ouracil<br> O deoxyribose<br> DETECTEET
    11·1 answer
  • Living organisms include bacteria, fungi ,plants, and animals . What is one thing that all living things have in common?
    15·1 answer
  • What is the haploid number in sea otter?
    6·1 answer
  • How does the mitochondria help maintain homeostasis?
    7·2 answers
  • What is a long term change that happens after a flood?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!