1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
2 years ago
7

Which major environmental factors can affect health?

Biology
2 answers:
brilliants [131]2 years ago
7 0

Answer:

The answer is poor air quality and water quality

ikadub [295]2 years ago
5 0

Answer:

poor air and water quality

Explanation:

You might be interested in
What are the keys to a strong lab procedure?​
Natali5045456 [20]

Answer:

Purpose: A brief description of why the experiment is being performed. Include details about the experiment, such as the methods used, a specific chemical reaction(s), and/or anticipated product.

Hypothesis: Provide a statement or two about the anticipated outcome of the experiment.

Experimental Procedure: A step-by-step description of the experiment including the chemicals, equipment, and/or methods used. Complete sentences must be used for the description. DO NOT simply copy the procedure from a lab manual or a handout. Condense the given procedure into steps so that you can understand and follow them.

Laboratory Safety: Give a complete, descriptive listing of the safety precautions, hazards, or other safety procedures that are needed for this experiment.

Experimental Data: Record all data resulting from the experiment in your laboratory notebook. The experimental data should be recorded in tabular form. Do not record your experimental data in your laboratory manual.

Observations: This section is used to record any qualitative observations and notes on the changes to the experimental procedure. Sudden bursts of scientific insight or other information during the experiment that may aid in the interpretation of the data generated are to be entered in this section. No points will be awarded when the observations are recorded outside of the laboratory. It is also important that you record your unknown number in this section of your notebook.

Calculations: Present outcome/summary of data analysis using tables, Excel graphs, and/or figures. List separately all pertinent mathematical equations followed by a sample calculation for each. Use the recorded data from the experiment when performing the calculations.

Results/Discussion: Questions that should be addressed in this section may include: Did the experiment work, and if not, why not? Were the results obtained in the experiment those expected based on the laboratory procedure? If the experiment was to be repeated, what improvements would be made? What types of errors occurred and how could they be corrected? How did the observations play a role in the outcome of the experiment? When applicable, you should compare your experimental value(s) to that of a published, literature value(s), commenting on the accuracy of your technique.

Conclusion: Summarize the findings of the experiment, which must include the final results of the experiment, e.g., the percent yield of a reaction, the identity of an unknown, etc. Look back at the purpose and hypothesis of your experiment and assess whether or not you met your goal in performing the experiment.

References: Include all pertinent information such as, your laboratory manual, textbooks, web sites, and any other library resources used in the preparation of your laboratory report.

7 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
All of the following except __________ developed in some vascular plants and are not present in any nonvascular plants.All of th
dem82 [27]

Answer:

Vascular plants have separate tubular tissues such as xylem, phloem for smooth transport of water, minerals and food while non-vascular plants do not show these attributes.

Explanation:

Although both life cycles are divided between the sporophytic and gametophytic generations, vascular plants have a dominant diploid sporophytic phase while non-vascular plants have a dominant haploid gametophytic phase.

Non-vascular plants are poikilohydric (they can withstand dehydration and can recover without any damage to their tissues), though they cannot control the water level in their cells and tissues. On the other hand, vascular plants are homoiohydry. They can survive in any habitat and can control the water content in cells and tissues, though they have low capacity to survive dessication compared to the non-vascular plants.

Non-vascular plants do not have true leaf. The leaves are mere chlorophyll containing. Photosynthesized food are directly sent from one cell to the other. They lack proper transport mechanism for food and water.

On the other hand, the vascular plants have complex multilayered leaf (cells) structure. The waxy layer cuticles on the leaves prevent dessication. That are more chlorophyll containing than their counterpart.

3 0
3 years ago
How are hydrogen bonds different from covalent bonds?
Likurg_2 [28]
The correct response is C.
7 0
3 years ago
Read 2 more answers
PLEASE HELP I WILL MARK BRAINLIEST
Alexxandr [17]

Answer:

It is Opaque. :)

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • One of your lab partners has followed the recommended procedure of running Gram-positive and Gram-negative control organisms on
    7·1 answer
  • Micah has straight hair. If he is homozygous for the gene that determines straight hair, what is true of his parents?
    11·1 answer
  • WRITE IN YOUR OWN WORDS! 50 POINTS!! WILL MARK BRAINLIEST
    13·1 answer
  • What name is given to this process? A cycle consisting of 3 steps. In the lower left is a single hydra, labeled 1. At the top is
    10·1 answer
  • What organisms break down chemical wastes in a treatment plant?
    14·2 answers
  • What molecule can be made from glucose and serves as a building material in the cell walls of a plant
    14·2 answers
  • The chemical agent or hazardous material but interferes with the bodies ability to transfer oxygen to the cells is
    15·1 answer
  • Complete the following sentence.
    14·1 answer
  • PLEASE HELPPP!!!!!!ASAP!!!!!!!!!!! PLEASEE!!FIRST ANSWE WILL BE MARKED BRAINLIST!!!
    14·2 answers
  • Identifique una molécula específica que aumente la concentración en la sangre como resultado de una mayor actividad del sistema
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!