1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergeinik [125]
3 years ago
10

List three uses of fats and oil

Biology
2 answers:
Maksim231197 [3]3 years ago
8 0

- to cook with

- to produce sufficient industrial products

- to conduct scientist experiments

Anuta_ua [19.1K]3 years ago
8 0
-cooking
-insulation
-industry
You might be interested in
You look the way you look because of ___
Sphinxa [80]
C
Because your DNA is made of nitrogen bases

Adenine
Guanine
Cytosine
Thymine
5 0
3 years ago
How can natural selection affect the songs that birds sing?
VMariaS [17]
Perhaps the bird’s calls could be less attracting and disorienting to predators and the ones with the said distinctive calls could have survived to repopulate and pass down the genes.
4 0
3 years ago
Rattlesnakes have thermoreceptors on the front of their faces called _____ organs, which allow them to detect infrared radiation
inn [45]

the answer to this question is pits

8 0
2 years ago
Read 2 more answers
SOMEONE PLZ HELP!!! How does immigration and emigration apply to human population growth?
Temka [501]
Immigration and emigration is typically done with the purpose of looking forward to a better and more prosperous life, a more comfortable life where the money you earn can last you a pretty long time and buy you enough thing to live more comfortable than where you used to live. Therefore, when you move to a prosperous country, having children is not something you’ll worry about given to the commodities you’ll have and the easy access to baby food and baby clothes and stuff, therefore, when people emigrate/immigrate to more prosperous countries, they’re comfortable with the idea of having more children, and that leading to population growth.
7 0
2 years ago
What do the chromosome pairs do in<br> meiosis?
Shalnov [3]

Answer:

it creates new combinations of genetic material in the 4 daughter cells

7 0
2 years ago
Other questions:
  • A body cell that is undergoing abnormal cell division is most likely
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The process of ________ involves a carrier protein that can transport a molecule across the cell membrane down its concentration
    10·1 answer
  • The correct spelling for the term that means pertaining to the tail is:_____.a) cadal.
    8·1 answer
  • Another term that describes genetic material, DNA or RNA is _____________.
    9·1 answer
  • Know difference between mass and weight
    11·2 answers
  • Capelin are fish found in the Atlantic amd Arctic oceans. In spring and summer, capelin are usually seen in the region between I
    7·2 answers
  • True/False- A magnet can be strong enough to erase computer evidence.
    9·1 answer
  • In 1980 Mount St. Helens in Washington state erupted. What were some of the destructive forces that occurred
    8·1 answer
  • PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!