Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The
zebrafish lineage is the studied gene who evolved most rapidly as shown in its
branch where it manifest to have the longest lineages.<span> The changing branch lengths indicates
that the gene has evolved at different rates in each lineages and the branch length
is proportional to amount of the genetic variation in each linear.</span>
I believe the answer is most likely
C): 4
I hope this is correct and helps
