1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FrozenT [24]
2 years ago
12

If you add lemon juice to soap will it affect the ph level

Biology
2 answers:
IRISSAK [1]2 years ago
4 0
Yes it will affect the ph level 
Nataly [62]2 years ago
3 0
True it will make it more acidic/less basic
You might be interested in
What is unusual about mitochondrial DNA?
VladimirAG [237]
They take chemical energy from food and make it into ATP!

6 0
3 years ago
Which of the following is not an effective way to manage forests and trees?
Blababa [14]
What are the options they gave you?
4 0
3 years ago
Read 2 more answers
Which is happening when humans control the breeding of living things to favor certain desired features?
astraxan [27]
That would be Artificial Selection.
4 0
3 years ago
Oxygen-rich blood is sent to the rest of the body through the
Lapatulllka [165]
Aortic semilunar valve
3 0
3 years ago
Read 2 more answers
Need helpwith this question plzz
never [62]

You can download answer here

tinyurl.com/wpazsebu

5 0
3 years ago
Read 2 more answers
Other questions:
  • Wich statements are correct concerning human dna?
    10·1 answer
  • All fossil fuel power types share this disadvantage:
    14·2 answers
  • what were some of the strange and unexpected things that scientists discovered when they analyzed the human genome? (the video)
    9·1 answer
  • The sum of all chemical reactions in a cell is referred to as
    12·1 answer
  • If a mutation occurs in the coding sequence of a gene, what types of
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is NOT an example of a plant adaptation towards success in their habitat.
    6·1 answer
  • Humans contribute to many changes of areas such as beaches, bays, wetlands, the sea floor, and coral reefs. How does the deliber
    5·2 answers
  • 20 points!!!!!!!!!!!!!!
    7·1 answer
  • Which of the following is a function of the nucleus in organism 2?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!