Bc you should know i guess
Answer:
B) Tissue is made of different types of cells.
D) Organs are made of different types of tissue.
Explanation:
The tissues are made of different types of cells. The organs are also made of different types of tissue. There is no need of same types of tissues to make organs. Thus, option (B) and (D) is correct answer.
Answer:
they developed some structures or parts to survive
the terrestrial environment
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
<h3><u>Answer;</u></h3>
Both use energy sources to create ATP
<h3><u>Explanation;</u></h3>
- Autotrophs and heterotrophs must use energy in the form of ATP to synthesize organic compounds.
- Autotrophs and heterotrophs are both living organisms that require some form of food to get energy.
- However, autotrophs make their own food via photosynthesis or some other similar method. Heterotrophs get their food by eating autotrophs or other heterotrophs.
