1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
densk [106]
4 years ago
12

Which of the following statements about agriculture societies is true?

Biology
2 answers:
Lapatulllka [165]4 years ago
6 0

Answer:

correct answer is A

Explanation:

patriot [66]4 years ago
3 0

Answer:

a.

Agricultural societies did not pollute the environment.

Explanation:

You might be interested in
In most animal cells, a complex network of proteins provides which of the following
vampirchik [111]
Its D - all the above 

4 0
4 years ago
Read 2 more answers
3
lakkis [162]
Because they both have a nucleus but both of them do not have a cell wall
7 0
3 years ago
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
the skin is the largest organ in your body which of the following describe the function of the skin???​
denpristay [2]

Answer:

where's the following?

7 0
3 years ago
Which of the following statements about antibodies is false?
Sloan [31]
(a) is false since antibodies are produced by body humoral immune system
7 0
3 years ago
Read 2 more answers
Other questions:
  • After leaving the stomach, chyme passes into the first segment of the small intestine called the ________
    10·1 answer
  • Child abuse/neglect is least likely to occur in what type of family?
    12·1 answer
  • If there was complete (100%) selection against an uncommon deleterious recessive genotype (aa) in the human population, would yo
    6·1 answer
  • The autonomic nervous system exerts its influence on
    14·1 answer
  • Which do you have the most of in your lungs: bronchi bronchioles or alveoli
    12·1 answer
  • How are malignant tumors different from benign tumors?
    12·1 answer
  • Which of the following is considered assimilation in the carbon cycle?
    7·1 answer
  • Most of the energy resources used to generate electricity are renewable.
    9·1 answer
  • PLEASE HELP ME
    6·1 answer
  • Explain how one body system not functioning properly can affect another body<br> system.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!