1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
3 years ago
13

Describe how this level of organization fits into the organization of the whole body.

Biology
1 answer:
krek1111 [17]3 years ago
5 0
I need more information to help you
You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which of the following is not part of the theory of evolution?
Feliz [49]

number 1 is not part of the theory of evolution.

Evolution is change in the heritable characteristics of biological populations over successive generations.

6 0
3 years ago
Read 2 more answers
The change of one base to another in a DNA sequence
PSYCHO15rus [73]
Where's teh image at
7 0
3 years ago
Which imaginary line divides Earth into the Northern and Southern Hemispheres?
stealth61 [152]
The Equator. It divides the lin
4 0
3 years ago
Read 2 more answers
Which processes are directly responsible for the formation of sediment?
suter [353]
Cementation and compaction

5 0
3 years ago
Other questions:
  • Which of the following statements is true? Very fertile soil is found near the top of a mountain. Moisture is the least importan
    6·2 answers
  • Successful fertilization depends more on the
    13·1 answer
  • What do you mean by Swayam
    15·1 answer
  • A plant with purple flowers is allowed to self-pollinate. Generation after generation, it produces purple flowers. This is an ex
    6·1 answer
  • What are the body’s three defenses? How do they differ from each other.
    12·1 answer
  • Everybody meu-nbht-zzn
    14·2 answers
  • Describe a similarity between carbohydrates and ATP.
    5·1 answer
  • Sam had a disease that weakened his heart so it could not pump properly. This heart problem
    14·1 answer
  • What is spirogyra in biology​
    13·1 answer
  • The cellular membrane across which ion flow varies during auditory transduction is the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!