1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
10

Suppose two plants with light purple/lavender flowers are crossed. About 25% of the offspring have white flowers, 25% have purpl

e flowers and 50% have lavender flowers. Which of the following could explain these results: codominance, incomplete dominance, or multiple alleles? Explain.
Biology
1 answer:
weqwewe [10]3 years ago
8 0

Answer:

Its a 50% chance of being purple and white

Explanation:

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
2 years ago
Plant cells, unlike animal cells, are characterized by the presence of a ______. Cell wall and contractile vacuole nucleus and c
Kay [80]

Answer:

The correct option is cell wall and central vacuole.

Explanation:

The cell wall can be described as an additional membrane around the cell membrane which is present in the plant cells but is absent in animal cells.

The plant cells also have a vacuole located at the center on the cell. The central vacuole is absent in animal cells. It stores the waste and other materials for the plant cell. The plant vacuole also provides support to the cell.

3 0
3 years ago
Can someone help me thank you for your time
kkurt [141]
The independent variable is the one that can be changed
I think the correct answer would be water temperature because on the table, the water temperature is increasing by 10 each time so it is changing.

hope I'm right and hope I helped :)
7 0
3 years ago
Pls help me answer this question and pls add a explanation!!!!
ivolga24 [154]

Answer:

The answer is G

Explanation:

This is because cells cannot just appear out of thin air all cells have to have come from pre-existing cells.

4 0
3 years ago
After applying a tourniquet, the injury from a patient's leg stops bleeding. this is called:
vekshin1

The process of having to apply a tourniquet in a person’s leg due to injury and with continuous bleeding in order to stop it is called hemostasis. This process, the hemostasis, is a process of having to stop the flow of blood which is important in scenarios like this, in order for the patient to prevent of having to lose more blood.

7 0
3 years ago
Other questions:
  • List negative effects of the use of chemical fertilizers
    6·1 answer
  • Semester biology reveiw) Animals
    10·1 answer
  • In a series of experiments, Avery treated heat-killed nonvirulent s bacteria with enzymes that degraded the proteins, dna, and r
    13·1 answer
  • Which of the following correlation coefficients is less likely to occur?
    5·1 answer
  • Glucagon acts upon the?
    12·1 answer
  • During exorcise, epinephrine car enhance skeletal muscle glycogenolysis through which of the following mechanisms? Release of Ca
    14·1 answer
  • What would happen if Glucoses could not happen in a cell
    9·1 answer
  • Your service club is offering a prize for the best community educational plan. Not only would you love to win the prize, but you
    5·1 answer
  • What is photo synthesis ?​
    15·1 answer
  • What is the energy conversion that occurs in photosynthesis?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!