1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna1 [17]
4 years ago
8

What is the difference between phagocytosis and pinocytosis?

Biology
2 answers:
stepladder [879]4 years ago
8 0
Phagocytosis is the engulfing of solid particle like substances by wbc which is neutrophils.

<span>the ingestion of liquid into a cell by the budding of small vesicles from the cell membrane.</span>

EleoNora [17]4 years ago
7 0
Phagocytosis is the process by which cells engulf large particles (such as bacteria) into vesicles.

Pinocytosis is moving large amounts of liquids (solutions) into the cell.

cell eating vs cell drinking
You might be interested in
When joined together, glucose and fructose form the disaccharide sucrose. Which of the following statements is FALSE?
Stells [14]
I think the correct answer from the choices listed above is option D. There is not false statement from the choices listed above. All are true about sugars. Hope this answers the question. Have a nice day. Feel free to ask more questions. 
7 0
3 years ago
Lateral inhibition occurs in most sensory systems. If a large area of the sensory periphery were stimulated in such a system (le
Sholpan [36]
<h2>Answer</h2>

Yes

<h2>Reason</h2>

2+2 is 4 -1 that’s 3 quick maths

8 0
3 years ago
A wildlife ranger is studying a large group of grey wolves in Yellowstone National Park. Which level of environmental organizati
tatuchka [14]
I most believe it’s d) organism
5 0
3 years ago
Read 2 more answers
Which of the following is true?
gayaneshka [121]

The answer is B.

A. False. Heterotrophs need to consume other organisms to make energy.

C. False. Thermophiles (notice the prefix 'thermo') are organisms that thrive at higher than normal temperatures.

D. False. Autotrophs make their own energy. They don't consume it from other sources.

5 0
4 years ago
What signals a cell to start dividing
Alex787 [66]
Its DNA, i.e. nucleus is in charge of it.  If the cell works inside of a multicellular organism, it will only divide if more cells are necessary.  (If growth is happening or cells are killed).  In a single-celled organism, it will divide as much as possible unless negative exterior forces are acting upon it.
7 0
4 years ago
Other questions:
  • The part of the brainstem that helps to coordinate movements is called the
    11·1 answer
  • Which statements describes how animals get their necessary water
    7·2 answers
  • What is the difference between a trait and a characteristic
    8·1 answer
  • WILL GIVE BRAINLIEST!
    12·1 answer
  • The junction of an axon with another cell is called a
    10·1 answer
  • What number of President was Andrew Johnson
    11·1 answer
  • Jak nazywamy podstawową niosobową formę czasownika??
    7·1 answer
  • What is the complementary base to cytosine in DNA?
    10·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • What is the approximate population of humans on Earth now?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!