Which beverage would most likely produce intestinal gas?

1 answer:

7 0

The correct answer is beer or soda.

Intestinal gas or air in the digestive tract usually exists as the natural consequence of swallowing and digestion. But sometimes gas can be excessive. Carbonated beverages, such as beer can increase the gas amount because of the yeast which converts the sugar in beer into CO2 and alcohol.

You might be interested in

12. Which molecules must be present in order for energy production to

MrRissso [65]

Answer:

C. oxygen

Explanation:

Oxygen is needed to help the process of turning glucose into ATP. The initial step releases just two molecules of ATP for each glucose.

4 0

4 years ago

Plz help don’t get was not at school

Wittaler [7]

1. elliptical 2. solar system

8 0

3 years ago

Which of the following is an example of active transport in a cell?

denis23 [38]

Answer:

the answer is D :)

Explanation:

Active transport uses energy molecules to move particles like sodium, against their concentration gradients, from areas of low concentration to areas of high concentration.

8 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

How do the sun, earth, and moon affect each other??

lesya [120]

So when the Moon rotates around the earth is pulls the water away from the earthcausing high tides. Low tide is caused by the moon and sun working at right angles to each other, their gravitational forces effectively cancel each otherout.

8 0

3 years ago