1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
13

I’m leaning towards C but then again I don’t know. I’m probably wrong

Biology
2 answers:
Sati [7]3 years ago
8 0
C is indeed correct!! :)
Savatey [412]3 years ago
7 0
C is correct. You are right
You might be interested in
How does the process of photosynthesis create food?
ra1l [238]
Your answer will be A.) hope this helps you good luck
8 0
3 years ago
Read 2 more answers
Sodium has the atomic number 11. How many electrons are in a sodium ion, which has the symbol Na ?
saw5 [17]
I had to draw a sodium atom so if i remember correctly there are 11 electrons, 11 protons, and 12 neutrons. Cx Hope I helped.
5 0
3 years ago
Blue whales have 44 chromosomes in every cell. determine how many chromosomes you would expect to find in the following:Sperm ce
baherus [9]

Sperm cell: We expect to find 22 chromosomes.

The spermatozoon is a small cell (5 micrometers in diameter), much smaller than the ovum, but with a movable tail (a flagellum) 60 micrometers long. To be lightweight and mobile, to quickly reach the egg, the sperm gains space by minimizing its cytoplasm and compacting its DNA. Head is covered with the acrosome, a pocket full of enzymes that will be used to pierce the membrane of the egg.

It is a haploid cell because it contains half of the genetic material of the individual, lost at the time of meiosis during the process of spermatogenesis that the primordial germ cells undergo in the seminiferous tubules of the testes.


Egg Cell: We expect to find 22 chromosomes.

The egg is the sexual cell (or gamete) produced by the females of the animals.

Like all gametes, the egg is haploid, it contains half of the chromosomes of the future embryo, so the number of chromosomes will be 22 instead of 44. Then this egg will meet a sperm cell to gather their chromosome and form an embryo of 44 chromosomes.


Daughter Cell from Mitosis: We expect to find 44 chromosomes.

Mitosis, which ensures the birth of cells identical to the mother cell during asexual multiplication (so the number of chromosomes will remain the same, it will not divide in two).

Mitosis is an asexual cell division. This means that it is just a division of a mother cell into two daughter cells, which will inherit exactly the same genetic inheritance.


Daughter Cell from Meiosis II: We expect to find 22 chromosomes.

Meiosis is a particular mode of division of the living cell by which an initial cell with 2n chromosomes (in this case 2n = 44 chromosomes), a diploid stage, gives rise to four daughter cells possessing only n chromosomes, a haploid stage (n = 22 chromosomes). Meiosis is one of the forms of cell reproduction, this process is performed on the gonads to produce gametes.

4 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Why do the products of genetic engineering must undergo many tests before they can be sold​
VashaNatasha [74]

if they did something wrong while doing it: for example, if they were supposed to make your future baby's hair pink but instead it made your baby be bald forever, this will be very harmful to the communities. they will lose a lot of money and receive lots of hate.

hope this helps. :)

stay safe, happy, and healthy! have a great day.

8 0
3 years ago
Read 2 more answers
Other questions:
  • URGENT!!
    14·1 answer
  • On a hot summer day, Tameka spilled water on the sidewalk, but a few hours later there was no evidence of the water. What most l
    11·2 answers
  • Make spindle fibers
    13·2 answers
  • Resting antigen presenting cells are not able to active naïve t-cells. <br> a. True <br> b. False
    5·1 answer
  • A population of lizards lives in an isolated area where local rocks contain a high concentration of radioactive elements. A stud
    12·2 answers
  • Give the word and chemical equations for respiration and photosynthesis
    11·1 answer
  • What was Galileo‘s contribution to the study of motion
    11·1 answer
  • Which of the following statements is a correct definition of 'adaptive features'?
    13·1 answer
  • 5. All of the following are functions of nonspecific defenses, EXCEPT:
    5·2 answers
  • When naming an organism using binomial nomenclature, which of the two parts of the species name are capitalized?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!