Answer:
Layer A is the crust and Layer B is the mantle.
It's C parasitism
for example tape worms are segmented flat worms that attach themselves to the inside of the intestine.They get food by eating the hosts of nutrients.While say the cow or pig get a disease,
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
I think C) availability of water is your best answer because alot of organisms count on water as a major resource because they need it to survive so a lack or a gain in the amount of water will majorly effect an ecosystem.
