1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna11 [10]
3 years ago
9

Where does our energy from from?

Biology
1 answer:
NISA [10]3 years ago
5 0
Our energy supply comes mainly from fossil fuels, with nuclear power and renewable sources rounding out the mix. These sources originate mostly in our local star, the Sun. Electricity falls into its own category because it's an energy carrier and not a primary source.
You might be interested in
Which of these is a disadvantage of using natural gas?
kaheart [24]
Since you say ‘which’ , in order to answer you, we would need the options you are given, but my answer would be
1. Not reusable
2. Might use up someday
3. Burning it will produce carbon dioxide and worsen global warming

Hope these can help :)
8 0
2 years ago
Please help ☁ ☂
sammy [17]
I think it is 3 i'm not sure but i'm about 70% sure 
5 0
3 years ago
Read 2 more answers
Where do plants get the carbon needed to make glucose molecules during the process of photosynthesis?
rosijanka [135]

Answer:

From CARBONDIOXIDE (CO2) found in the atmosphere

Explanation:

Photosynthesis is a process performed by autotrophic organisms like green plants. It is a phenomenon whereby these plants manufacture their own food (sugars) using an inorganic carbon source in the presence of sunlight to provide energy.

The major end product of photosynthesis is glucose, which has a carbon constituent i.e. C6H12O6. However, this carbon needed to make glucose is got from an inorganic molecule called CARBON DIOXIDE, which the plants take from the atmosphere in via the stomata on their leaves.

4 0
2 years ago
Daniel has a sample of pure copper. Its mass is 89.6 grams (g), and its volume is 10 cubic centimeters (cm3). What's the density
MatroZZZ [7]

Answer:

io

Explanation:

5 0
3 years ago
Can someone please help me !!???
NemiM [27]

Answer:

d

Explanation:

that is  how life began

5 0
3 years ago
Other questions:
  • During independent assortment, ____________ chromosomes separate. This separation is ____________ ; it is due to their alignment
    12·1 answer
  • When an organism breaks down organic molecules, some of the energy that had been stored as chemical energy is lost as heat. this
    8·1 answer
  • What are the proteins used in active transport called?
    11·2 answers
  • How is there diversity in all living things?
    12·2 answers
  • The blood veins is
    14·2 answers
  • The hydrologic cycle maintains a balance of earths water because____
    14·1 answer
  • Essential amino acids cannot be produced by the body, so they must come from our diet. We can get them from eating foods that co
    5·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Although farmers once used only organic fertilizers to replenish nutrients in the soils, some have been replaced with synthetic
    11·1 answer
  • Hello there,can you say what's biology?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!