1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
4 years ago
9

In winter, although many parts of Europe have heavy snow falls, the sea ports remain ice-free and ships come and go. What could

be a reason why the sea ports remain ice-free?
A) A warm ocean current flows along the coast
B) A cold ocean current flows along the coast
C) The coastal regions have very moderate winters
D) Warm winds blow from the continent, melting the ice
Biology
2 answers:
son4ous [18]4 years ago
8 0

The answer is (A. A warm current flows along the coast.) Currents carry cold and warm water from place to place. It's an amazing phenomenon that scientists are still trying to fully figure out.  Some think it's caused by wind, others think it's caused by the shifting of the tectonic plates, but one thing's for sure, currents are VITAL for this planets life.

Usimov [2.4K]4 years ago
7 0

Answer:

Option (A)

Explanation:

<u>Westerlies are the warm wind blowing in the mid-latitudes from the western direction towards the eastern direction in both the hemisphere</u>. It originates at the 30° latitudes from the high-pressure region and moves towards the region that are located at 60° latitude.

Since Europe is located between the latitude of 30° to 60° in the northern hemisphere, so it experiences the strong westerly winds. <u>As this warm wind comes from the tropical region so they bring warmer air currents often accompanied by rainfall. This wind when reaches the western coastal part of Europa the ice present there gets melted</u>.

so the ports remain ice-free during the winter season.

Thus, the correct answer is option (A).

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Hydrolysis reactions involving lipids and carbohydrates are shown
Romashka [77]

Answer:

this da go

Explanation:

Hydrolysis reactions involving lipids and carbohydrates are shown

below. What do the two reactions have in common?

4 0
1 year ago
I'm the human body which system function is detecting and responding to stimuli?
Nadusha1986 [10]
In the human body the nervous system function is deleting and responding to stimuli.
8 0
3 years ago
Migrating fibroblasts can be treated with various chemical agents while they are migrating. Explain what you expect for each of
goblinko [34]

Answer:

c

Explanation:

4 0
3 years ago
Dependent variable:
Ratling [72]

Answer:

the

Explanation:

7 0
3 years ago
Other questions:
  • A DNA strand has the sequence ACCGAGCTT. Which is the complementary strand of RNA?
    15·2 answers
  • This planet is an extremely light colored blue, and is the 7th planet from the Sun.
    8·1 answer
  • How does mRNA differ from DNA?
    7·2 answers
  • Help me please i need to get this done can you pls help pls and thank you
    5·1 answer
  • Unlike transcriptional termination in prokaryotes, termination in eukaryotes (by RNA polymerase II, anyway): depends on a specif
    6·1 answer
  • Which process wears away tall sandstone rock formations due to wind?
    9·1 answer
  • Charles Darwin suggested that Africa is the birthplace of the earliest hominin species because... Group of answer choices he fou
    13·1 answer
  • All living organisms are made up of cells. Cells are the basic units of life. In complex living organisms, cells are organizer i
    10·2 answers
  • Which observation describes an increase in the interrelatedness of the global
    13·1 answer
  • This text is from the transcript of the video "Adélie Penguins" from the NOAA web site Ocean Today.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!