1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
5

You have lost the sensation, but not movement, in one of your hands due to a problem with your spinal cord neurons. Based upon t

hese symptoms, what type of neuron was most likely affected
Biology
1 answer:
Usimov [2.4K]3 years ago
7 0

Answer:

A sensory neuron.

Explanation:

The nervous system can be divided in two systems: the central nervous system and the peripheral nervous system. The central nervous system (CNS) is composed by the brain and the spinal cord. The peripheral nervous system (PNS) consists of the nerves and ganglia. Neurons are specialized cells that form the basic functional unit of the nervous system. There are three types of neurons: sensory, motor and interneurons. The sensory neurons are in charge of bringing signals into the CNS, and the motor neurons are in charge of carrying signals out of the CNS. The interneurons act as intermediaries, passing information between two neurons.  

As the name implies, sensory neurons are activated by the senses, for example: sound, visible light, physical contact (heat and cold), chemical signals (smell and taste). The loss of sensation in one hand would be the result of a damaged sensory neuron.  

You might be interested in
Which of the following is not a stage of cell respiration
rewona [7]
Fermentation
The electron transport chain gives off 32 ATP the kreb cycle gives off 2 and so does glycolysis. Fermentation happens in muscles or alcohol
7 0
3 years ago
Read 2 more answers
Please help will give brainless !!!!!:)
Anestetic [448]

Answer:

they start to run out of places to stay cool and then will eventually run out of food to eat then they will die. hope this helps

7 0
3 years ago
After duplication, at what point does a cell become two cells with identical DNA?
professor190 [17]
Cytokinesis is the point at which a cell with duplicated genetic material becomes two daughter cells with identical DNA.
5 0
3 years ago
Read 2 more answers
Which of the following statements about NAD+ is true?
irga5000 [103]

Answer:

NAD+ is reduced to NADH during glycolysis, pyruvate oxidation, and the citric acid cycle.

Explanation:

8 0
3 years ago
Two cells in the same organism differ only in the number of chloroplasts they contain. The first cell has multiple chloroplasts,
ICE Princess25 [194]

Answer:

Two cells in the same organism differ only in the number of chloroplasts they contain. The first cell has multiple chloroplasts, and the second cell has very few. What would most likely characterize these cells? The second cell would not be able to produce as much food because it could not capture sunlight

8 0
3 years ago
Other questions:
  • What kind of section would have to be made to cut the brain into anterior and posterior parts?
    11·1 answer
  • When a comet nears the sun what happens to its nucleus
    10·2 answers
  • A group of large, colorful feathers the answer is 5 letters
    13·2 answers
  • Plz help!!!!<br> Answer
    14·1 answer
  • Fifty seeds were selected at random from each of 5 bags of seeds,and were kept under standardised conditions favourable to germi
    10·1 answer
  • Which of the following applies to skeletal muscle? Select all that apply. A : moves food and substances through the GI tract B :
    15·2 answers
  • I need the answer please
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Explain the importance of using engine powered pump for irrigation works.​
    13·1 answer
  • The two new cells formed after the completion of cytokinesis are called copied cells.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!