1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
7

During what reproduction, cells reproduce identical and unidentical offspring

Biology
1 answer:
Masja [62]3 years ago
7 0
Sex... I think ? Is it multiple choice
You might be interested in
1) Why is the epicenter of the earthquake limited to two locations after you have data for him to seismograph stations?
frez [133]

Answer:

Answer for question 2:

It is important to receive data from three separate locations because the more we know  about the seismic waves and the places that they are more we gain for learning  about them.

Explanation:

7 0
3 years ago
What contributes to two-thirds of foodborne illness outbreaks in restaurants?
german
I think the correct answer would be sick food service of the employees. Poor food handling contributes to two-thirds of foodborne illness outbreaks in restaurants. When employees do not follow correct procedures when handling food, it is possible for poisoning or acquiring a disease to happen.
8 0
4 years ago
A food chain is represented below.
soldi70 [24.7K]
The answer is 4 chemical energy from the grass.
HAPPY NEW YEAR!
5 0
3 years ago
Read 2 more answers
describa la evolución de los seres humanos a partir de los primates iniciales. incluye en su análisis características como la vi
Troyanec [42]
No se la respuesta talbes pon una foto para que sea más fácil

aquí todos hablan inglés tienes que poner donde dise la materia en spanish/español
6 0
3 years ago
What role does oxygen play in a plants life?
aleksandrvk [35]
Plants need oxygen to survive , no oxygen mean the plant will diePlants do need oxygen to survive. They respire (take in oxygen, give off carbon dioxide) the same way that animals do. The difference is that during the day, plants also perform photosynthesis, in which they take in carbon dioxide and give off oxygen.Plants require oxygen for respiration to carry out their functions of water and nutrient uptake. In soil adequate oxygen is usually available, but plant roots growing in water will quickly exhaust the supply of dissolved oxygen and can be damaged or killed unless additional air is provided. A common method of supplying oxygen is to bubble air through the solution. It is not usually necessary to provide supplementary oxygen in aeroponic or continuous flow systems.Oxygen is vital ingredient in plant survival
6 0
3 years ago
Other questions:
  • How old is our species Homo sapiens
    12·1 answer
  • Imagine we reach the year 2050 and we have surpassed the the projected global population. World wide we are running out of fresh
    5·1 answer
  • In which of the following situations is salinity highest?
    8·2 answers
  • What property of a magnifying lens is most responsible for allowing it to magnify a penny?A. It can reflect light.B. It can refr
    10·2 answers
  • Which plant has a visible leaf modification that will help it conserve water in extremely dry environments?
    9·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • this project, you will analyze claims about the causes of inherited genetic variation. You will then make your own claim based o
    14·1 answer
  • Always return the
    11·1 answer
  • Which choice describes a strategy used to help restore cod populations?
    15·2 answers
  • - How would you classify the relationship between coral and the small crabs?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!