1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
3 years ago
11

If a cell is producing lactic acid, what molecule is most likely unavailable to that cell

Biology
1 answer:
NISA [10]3 years ago
8 0
That would be a lactic acid molecule.

Lactic acid, also known as 2-hydroxypropanoic or milk acid, is a compound formed when glucose is broken down under certain conditions in a living creature or by some types of bacteria. In a person, for example, it is an important part of producing energy for strenuous exercise and helps with certain liver functions. During extremely intense exercise, it can buildup to excess and cause short-term burning sensations in muscles. This acid can also be found in certain dairy products, such as yogurt<span>, as well as sourdough breads and some beers and wines as a result of fermentation.</span>
You might be interested in
He sequence of ________________ in a DNA molecule determines the protein that will be produced.
miss Akunina [59]
<span> nucleotide bases
</span>https://www.google.com/search?q=He+sequence+of+________________+in+a+DNA+molecule+determines+the+pro...
7 0
3 years ago
In the first stage of cellular respiration (glycolysis, two molecules of pyruvate are produced. in the remaining stages of cellu
hram777 [196]
In the first stage of cellular respiration (glycolysis, two molecules of pyruvate are produced. in the remaining stages of cellular respiration, a number of additional products are produced, such as ______ATP____. these other stages occur in the _____Mitochondria_____.
4 0
3 years ago
What information is necessary to understand how a virus produces the proteins it requires?
konstantin123 [22]

Answer:

A is the answer i had same answer

6 0
3 years ago
Question:
o-na [289]
Cell - Egg Cell
Tissue - Muscle tissue
Organ - Lung
Organ system - Respiratory system 
Organism - Dog
4 0
4 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • Besides supporting and protecting a cell, the cell membrane __ what enters and leaves the cell??
    11·1 answer
  • A patient has recently been diagnosed with an acoustic neuroma. the nurse helps the patient understand that:
    10·1 answer
  • Plant respiration occurs: during sunlight only during night only primarily at night
    10·1 answer
  • Which statement is not true of a seed?
    5·1 answer
  • if someone hid an accident, and a metal rod goes through the body’s thoracic cavity, which organ could suffer severe damage?
    10·2 answers
  • Leaves are important plant structures because they?
    12·1 answer
  • A plant with variegated (two-coloured) leaves was left in the sun for several hours. A piece of one of its leaves were then deta
    12·2 answers
  • The proliferation of angiosperms is because they are
    9·2 answers
  • Compare the vagina and the anus. How does the fact that the vagina has a mucous membrane lining and the anus does not affect the
    6·1 answer
  • 1. What are the optimal conditions needed for this severe weather events?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!