1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garri49 [273]
3 years ago
6

Principal types of crime in United States include ...

Biology
2 answers:
Jet001 [13]3 years ago
5 0
The correct answer is (d) all of the above :-)
Marina86 [1]3 years ago
3 0
The answer is D. all of the above.
You might be interested in
A cylinder at left with balls evenly spaced throughout the cylinder has an arrow leading to a cylinder at right cylinder with ba
nata0808 [166]

Answer:

C. Atoms lose energy as a gas changes to a solid.

Explanation:

Physical changes of matter take place by adding or removing energy from the matter.

In the given images, The<em> left cylindrical is showing gas phase while the right cylindrical is showing a solid phase.</em>

The process of conversion of gas into solid is called deposition. Deposition process takes place when atoms lose their energy and have high kinetic energy so they directly convert into solid and not into liquid.

Hence, the correct option is "C".

3 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
A. Which form of nitrogen in the soil is NOT usable by organisms?
Colt1911 [192]

Answer:

A)Fixation. Nitrogen in its gaseous form (N2) can't be used by most living things

B) it can not be used because it most be converted or, ’fixed’  to a more useable form. To do this it goes through a process called fixation.fixation is the change in a gene pool from a situation where there exists at least two variants of a particular gene (allele) in a given population to a situation where only one of the alleles remains.

C) This form can be made more usable if it’s converted. It has to go through the process of fixation so the gene pool changes.

Explanation:

4 0
3 years ago
Read 2 more answers
Hydrogen + Chlorine Dot Structur
Finger [1]
I think this is what you are referring to.

Hope this helps.

5 0
2 years ago
If the person drank a large volume of water, far more than was needed by the body, predict what would happen to glucose, urea, a
omeli [17]

Answer:

there would be less of these components in urine

Explanation:

7 0
3 years ago
Other questions:
  • Within the Amish community is an unusually high frequency of the gene that causes polydactylism (having 6 digits on one or more
    7·1 answer
  • 50 things that use electricity
    7·1 answer
  • What organism produces about half of the oxygen on earth?
    6·1 answer
  • What kind of weather does an occluded front produce?
    13·2 answers
  • The Y chromosome in human males...?
    11·2 answers
  • An organic compound is one that is based on bonds of nitrogen<br> True or False
    5·1 answer
  • When elderly individuals live near each other and pool resources to promote aging in place, this is called _____.?
    6·1 answer
  • Bacteria is the simplest of cells. One special feature of bacterial cells that helps it survive in hostile environments is its
    5·2 answers
  • Which part of an antibody recognizes and binds antigens?
    8·1 answer
  • Compare the Early Earth's Atmosphere to today's Atmosphere. What change in the atmospheric conditions impacted life on earth the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!