1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
3 years ago
7

The illustration shows a kind of animal that is a free living organism what is the common name of the group that contains this o

rganism
Biology
1 answer:
Sladkaya [172]3 years ago
4 0

Answer:

the group that contains this organism is protozoa

You might be interested in
What are the consequences of moving from underground mining to surface mining? (site 1)
Gwar [14]
<span>Different pressure levels
 Hope this helps and please award brainly :)
</span>
4 0
3 years ago
Read 2 more answers
What is the difference between an epidemic and a pandemic?
Vilka [71]

Answer:

Pandemic is related to disease and epidemic isn't

Explanation:

6 0
3 years ago
Read 2 more answers
I didnt know if this is biology or physics but PLEASE HELP ME
Reptile [31]

Answer:

They would weigh 33 lbs.

Explanation:

have a good day!

5 0
2 years ago
One example of competition
Svet_ta [14]
A chase of cheetahs and lions and how they hunt the same prey and have to compete to get it first.
5 0
3 years ago
If anna had a child with a man with sickle cell anemia, predict whether that child would also have sickle cell anemia. draw out
borishaifa [10]

The child has a 100% chance of having Sickle Cell Disease

Download pdf
7 0
3 years ago
Other questions:
  • A child brought to the emergency department is exhibiting significant signs of hypovolemic shock for which intravenous therapy i
    8·1 answer
  • What type of blood do reptiles and amphibians have? If it depends on species please right them down.
    6·1 answer
  • Draw an atom showing and labeling the nucleus and the electron cloud
    11·1 answer
  • Crustal movements in one location can affect locations far away.What evidence from the text supports this conclusion?A. Steady a
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Inang<br>mukaangaana<br>wa<br>men<br>CARA<br>mwen<br>Stible<br>ther<br>Macaman<br>wa<br>ut​
    11·2 answers
  • Which substance is a solid?
    10·2 answers
  • Define carbohydrate and provide an example.
    12·1 answer
  • Ethyl alcohol is a byproduct of both Lactic Acid and Alcoholic Fermentation.
    7·2 answers
  • In a species of walruses, tusk size is controlled by a single gene that has only two alleles. The same species lives on two diff
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!