1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fynjy0 [20]
3 years ago
13

A plant using the sun to grow leaves; this is an example of

Biology
2 answers:
alex41 [277]3 years ago
7 0
A. photosynthesis.

Photosynthesis is the process of turning solar energy into food. This process is done by organelles (mini organs) in the cells of a plant. These organelles are called cytoplasts.
oksano4ka [1.4K]3 years ago
3 0
The answer is a photosynthesis
You might be interested in
I need help please with this...
statuscvo [17]

Answer:

If the order is solid, liquid, gas

Explanation:

Compressibility:

solid- not compressible

liquid- not compressible

gas- compressible

Shape and Volume

solid: definite shape and definite volume

liquid: indefinite shape and definite volume

gas: indefinite shape and volume )varies with temperature and other factors)

7 0
3 years ago
What are characteristics of all plants
vodomira [7]
- photosynthesis ( use the Sun to create their own energy )

- roots ( what is attached to the ground and bed of the plant)

- plants grow from seeds

- all plants have stems ( budding)

- most plants are green

- all plants need water and sunlight to grow

- paper is made from plants

- all plants have a vacuole and chloroplast cell

please vote my answer branliest . Thanks
5 0
3 years ago
Describe some of the modifications that polypeptide chains undergo before becoming functional proteins
umka2103 [35]
Polypeptide chains undergo some modifications before they become fully functional. Some of these modifications include: proteolytic cleavage, lipidation and glycosylation. Proteolytic cleavage refers to the removal of some amino acids from a polypeptide chain by proteases in order for the protein to become active. An example of a substance that is modified through this process is insulin.
4 0
3 years ago
Why can rats smell almost three times more compounds than humans?
Hunter-Best [27]
<span>The smell of Danger.
Researchers have discovered a single compound found in high concentrations in the urine of carnivores that triggers an instinctual avoidance response in mice and rats. This is the first time that scientists have identified a chemical tag that would let rodents sense carnivores in general from a safe distance.</span>
4 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Conducting research about an occupation, company, or job can increase your employability.
    14·2 answers
  • A magnetic field protects Earth from the Sun's high-energy particles. What two processes are involved in the formation of Earth'
    10·2 answers
  • The process of cellular respiration, which converts simple sugars such as glucose into co2 and water, is an example of _____. vi
    5·1 answer
  • What biome would contain the most trees
    5·1 answer
  • How did the enactment of the Endangered Species Act change the number of bald eagles in the United States after it was adopted i
    6·1 answer
  • What eats common king snake and what eats it
    5·2 answers
  • Changes to the global climate could include
    13·1 answer
  • Some homes have stairs that are too steep or narrow for moving large pieces of furniture. In such cases, furniture may be lift e
    14·1 answer
  • Does Iodine have cations or anions? PLEASE THIS IS REALLY HARD?!
    14·1 answer
  • Which of the following DOES NOT regularly use the atmosphere during its process?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!