1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr402 [8]
3 years ago
15

Which of the following statements about horizons is true?

Biology
2 answers:
Lubov Fominskaja [6]3 years ago
5 0

Answer:

Answer:

Your answer would be D.

They are defined by their different physical features.

hope it helps!

Readme [11.4K]3 years ago
3 0

Answer:

Your answer would be D.

They are defined by their different physical features.

hope it helps!

You might be interested in
Can someone please correct me or tell me if I’m correct please that will be lovely
Ipatiy [6.2K]

Answer:

A

Explanation:

Destruction of habitat is not going to preserve the habitat.

8 0
2 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
vibrations from the tympanic membrane to the oval window are transmitted by the structures at which numbers?
spin [16.1K]

The 3 and 4 are the structures at which the tympanic membrane to the oval window are communicated.

<h3>An example of a tympanic test</h3>

How well your middle ear is functioning is determined through a test called tympanometry. By tracking the motion of your eardrum, it does this. The outer ear, middle ear, and inner ear are all separate structures that make up your ear. You receive sound as energy or vibrations through your outer ear.

<h3>The tympanic bone's location is unknown.</h3>

The temporal bone's tympanic portion, which surrounds the external portion of the ear canal, is a curving plate of bone that sits under the squamous portion, in front of the mastoid process.

To know more about Tympanic visit:

brainly.com/question/15572102

#SPJ4

3 0
11 months ago
Norman's mother received new cast iron pot for Mother's Day. She was happy, but was reluctant to give up her copper pot, which h
Phoenix [80]
The answer is A because the heat for the copper is 0.38 and the iron is 0.45 so the copper heats the food faster than the iron
8 0
3 years ago
2. How much does the average baby weigh when bom?
Alexus [3.1K]

Answer:

4 to 5 kg

not very certain in pounds 1b)

4 0
2 years ago
Read 2 more answers
Other questions:
  • John, a 52-year-old construction worker, was recently diagnosed with diverticular disease. how could his breakfast be improved t
    11·1 answer
  • Which of the following is not a part of Darwin’s theory of evolution?
    6·2 answers
  • What would happen if photosynthesis on Earth stopped?
    11·1 answer
  • What are the 2 main parts of the cell cycle and what is happening to the cell in each stage?
    8·2 answers
  • When a____ air mass moves toward a warmer air mass, it causes a cold front. The ____ air rises, leaving ____ temperatures in the
    14·2 answers
  • Woolly mammoths were grass-eating mammals that resembled elephants but with heavy coats, large tusks, and small ears that made t
    8·2 answers
  • 1)Describe two ways that receptor-mediated endocytosis is different from phaocytosis.
    6·1 answer
  • Describe the feature of cell mbrane​
    10·1 answer
  • A sample compound with a molar mass of 34.00g/mol is found to consist of 0.44g H and 6.92g O. Calculate both empirical and molec
    6·1 answer
  • How can i compare school to a vacuole​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!