1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tomtit [17]
3 years ago
6

What is a key item still in an environment during the second succession?

Biology
1 answer:
ale4655 [162]3 years ago
5 0

Answer:

Soil

Explanation:

Ecological succession, which refers to the series of changes that occurs in an ecosystem over time, is of two types viz: primary succession and secondary succession. In primary succession, a new or barren area (usually a rocky surface) is colonized by organisms such as lichens called PIONEER SPECIES.

However, in secondary succession, an ecological disturbance such as natural disasters disrupt the ecosystem causing the area, which was made void, to be recolonized by organisms. Note that, despite the disturbances, a key factor which is SOIL is still present in the environment to sustain the growth of the recolonizing organisms in secondary succession

You might be interested in
Describe the unique appearance of diatoms. what chemical compound composes their outer covering, and what is this shell called?
Natasha2012 [34]
Diatom Cells are enclosed in a cell wall made up of silica or hydrated silicon dioxide namely frustule. The frustule has small walls where nutrients enter, enabling it to perform photosynthesis the same way plants do.
6 0
3 years ago
What attaches itself to the jet stream and, in sense, tells you where the stratosphere begins?
liraira [26]
Its the tropopause

hope this helps you


4 0
3 years ago
Imagine that a researcher is studying a population of nerve cells known as the neural crest. In mice, when these cells fail to f
Svetlanka [38]
<h2>Neural crest </h2>

Explanation:

The neural crest likely forms: neurons and glia of the peripheral nervous system

  • The neural crest are bilaterally paired strips of cells arising in the ectoderm at the margins of the neural tube
  • In the body region, neural crest cells also contribute the peripheral nervous system (both neurons and glia) consisting of sensory ganglia (dorsal root ganglia), sympathetic and parasympathetic ganglia and neural plexuses within specific tissues/organs
  • The nervous system is made up of specialized cells which includes nerve cells (or neurons) and glial cells (or glia)
  • Neurons are the basic functional units of the nervous system, and they generate electrical signals called action potentials, which allow them to quickly transmit information over long distances
  • Glia are also essential to nervous system function, but they work mostly by supporting the neurons
7 0
3 years ago
Why is humus important?
Sauron [17]

Answer:

D) It decreases water movement.

Explanation:

Humus is known as part of the soil formation. It is characterized by various qualities some of which include containing nutrients such as nitrogen. It is also characterized by its ability to retain water content or soil moisture. Humus is made from the decays of plants wastes such as leaves.

Hence, in this case, the correct answer is Humus is important because "It decreases water movement."

7 0
3 years ago
Read 2 more answers
Song suggestions??? lmk
barxatty [35]
Freaking out on the interstate, meet me in the hallway, driver’s license , flashing lights
4 0
3 years ago
Read 2 more answers
Other questions:
  • Two primary factors of Extinction​
    14·2 answers
  • What is the difference between parasite and a saprotroph?
    9·1 answer
  • Identify the types of genetic recombination.
    9·1 answer
  • Ten different types of culture media were inoculated with the same strain of bacteria and incubated at the same temperature. Nin
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Nombre tres maneras en que el pez usa sus aletas
    9·1 answer
  • What is mensuration?​
    14·2 answers
  • Summary of the cell membrane structure.
    12·1 answer
  • If a culture of liver cells were deprived of amino acids, which category of macromolecule would the liver cells not be able to c
    8·1 answer
  • In replication of a linear double-stranded dna molecule, one end of each strand becomes shorter in each round of replication. Th
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!